Mutation screening of two candidate genes from 13q32 in families affected with Bipolar disorder: human peptide transporter (SLC15A1) and human glypican5 (GPC5)

Table 4 Human glypican5 (GPC5) : PCR Primers and Annealing temperature

Exon	cDNA U66033	Forward Primer 5' → 3'	Reverse Primer 5' → 3'	Product Size	Annealing Temperature
1	1–178	cgctgtgtcttccacgtct	ctacccgcaccaagcatc	410	60 (5%DMSO)
2	175–339	gtgcaggactggtcataacg	gtttccccaatccaactcag	455	60
3	338–1044	agcagatggacggtgttagc	caagaagtcagactgaaaatgtg	797	60 (DT)
4	1033–1168	gcataccacataaatgtccatga	ggcttactttcttttctctttctgg	408	60
5	1169–1294	ttgatggcctttattgtgga	tcaggttttgttgttcttttcc	352	48
6	1293–1415	gaggaaattccgacctcaaa	cactgcatattgactgcatcc	401	60
7	1414–1576	ccatttccaattcctcttgc	tgtaagactttgcccgctatt	466	60

ISSN: 1471-2164