Skip to main content

Table 4 Human glypican5 (GPC5) : PCR Primers and Annealing temperature

From: Mutation screening of two candidate genes from 13q32 in families affected with Bipolar disorder: human peptide transporter (SLC15A1) and human glypican5 (GPC5)

Exon cDNA U66033 Forward Primer 5' → 3' Reverse Primer 5' → 3' Product Size Annealing Temperature
1 1–178 cgctgtgtcttccacgtct ctacccgcaccaagcatc 410 60 (5%DMSO)
2 175–339 gtgcaggactggtcataacg gtttccccaatccaactcag 455 60
3 338–1044 agcagatggacggtgttagc caagaagtcagactgaaaatgtg 797 60 (DT)
4 1033–1168 gcataccacataaatgtccatga ggcttactttcttttctctttctgg 408 60
5 1169–1294 ttgatggcctttattgtgga tcaggttttgttgttcttttcc 352 48
6 1293–1415 gaggaaattccgacctcaaa cactgcatattgactgcatcc 401 60
7 1414–1576 ccatttccaattcctcttgc tgtaagactttgcccgctatt 466 60