Skip to main content

Table 2 The primer sequences and necessary concentrations for the quantification via real-time PCR.

From: Digital analysis of cDNA abundance; expression profiling by means of restriction fragment fingerprinting

product forward primer conc. reverse primer conc.
GAPDH ATCAACGGGAAGCCCATCA 100 nM GACATACTCAGCACCGGCCT 100 nM
MCP-2 CTTCTCTGGGCTGACAGGGA 300 nM TCTACGCAGTGCTTCTTTGCC 300 nM
cystatin C CAAGAAGAGTGGAGCCAGGG 50 nM GCAGGCAGGTTCTGCACAT 50 nM