Skip to main content

Table 1 DNA sequences

From: High accuracy genotyping directly from genomic DNA using a rolling circle amplification based assay

Open Circle Probes Length Nucleotide Sequence
FV Normal 78 bases 5'-GCCTGTCCAGGGATCTGCTTCTTCGGTGCCCATCGCGCAGACACGATA GAGGAATACAACAAAATACCTGTATTCCTC-3'
FV WT-no hairpin 68 bases 5'-GCCTGTCCAGGGATCTGCTTCTTCGGTGCCCATCGCGCAGACACGATA ACAAAATACCTGTATTCCTC-3'
FV Mutant 78 bases 5'-GCCTGTCC AGGGATCTGCTCTGTTATCGGCCGTCGCGCAGACACGATA AAGGAATACAACAAAATACCTGTATTCCTT-3'
FV Mut-no hairpin 68 bases 5'-GCCTGTCCAGGGATCTGCTCTGTTATCGGCCGTCGCGCAGACACGATA ACAAAATACCTGTATTCCTT-3'
FII Normal 79 bases 5'-agcctcaatgctcccagtgcACAAGACCGAAAGGGTAGTCGCGGATTGTTG CGCTGAGAaataaaagtgactctcagcg-3'
FII Mutant 79 bases 5'-agcctcaatgctcccagtgcACTCAATCCCAGGCGAGTCGCGGATTGTTG TGCTGAGAGaataaaagtgactctcagca-3'
H63 Normal 99 bases 5'-ATCATAGAACACGAACAGCTGGTAGTATTGATCGGCCACTGGTATCTCGTCCG TGCTAGAAGGAAACATGAGAGTAGGCTCCACACGGCGACTCTCATG-3'
H63 WT-no hairpin 99 bases 5'-ATCATAGAACACGAACAGCTGGTAGTATTGATCGGCCACTGGTATCTCGTCCG TGCTAGAAGGAAATCAAGAGATGGGCTCCACACGGCGACTCTCATG-3'
H63 Mutant 99 bases 5'-ATCATAGAACACGAACAGCTGGTAATGTTGACTGGTCACACGTCGTATCGTCCG TGCTAGAAGGAAAGATGAGAGTCAGGCTCCACACGGCGACTCTCATC-3'
H63 Mut-no hairpin 99 bases 5'-ATCATAGAACACGAACAGCTGGTAGTATTGATCGGCCACTGGTATCTCGTCCG TGCTAGAAGGAAATCAAGAGATGGGCTCCACACGGCGACTCTCATC
C282 Normal 89 bases 5'-CCAGGTGGAGCACCCAGGTCAGTTATCGGGCCGAGGCGCGAGTGTAAA CACGTATATCTCTCCCCTGGGGAAGAGCAGAGATATACGTG-3'
C282 Mutant 90 bases 5'-CCAGGTGGAGCACCCAGGTTCTACCTCAGCCCGAAGGCGCGAGTGTAAA CACGTATATCTCTCCCCTGGGGAAGAGCAGAGATATACGTA-3'
Primers Length Nucleotide Sequence
FV Normal P1 31 bases 5'-/56-FAM/ TCATTCGCAATCAATGGGCACCGAAGAAGCA-3'
FV Mutant P1 31 bases 5'-/5Cy3/TCATTCGCAATCAACGGCCGATAACAGAGCA-3'
FV P2 15 bases 5'-CGCGCA GACACGATA-3'
FV 5' allele specific primer 18 bases 5'-GAGGAATACAACAAAATA-3'
FV 3' allele specific primer 15 bases 5'-GATCCCTGGACAGGC-3'
FII Normal P1 28 bases 5'-/56-FAM/ TCATTCGCAATCACCCTTTCGGTCTTGT-3'
FII Mutant P1 28 bases 5'-/5Cy3/ TCATTCGCAATCACGCCTGGGATTGAGT-3'
FII P2 15 bases 5'-AGTCGCGGATTGTTG-3'
FII 5' allele specific primer 15 bases 5'-CACTGGGAGCATTGA-3'
H63 Normal P1 29 bases 5'-/56-FAM/ TCATTCGCAATCAGATACCAGTGGCCGAT-3'
H63D Mutant P1 27 bases 5'-/5Cy3/ TCATTCGCAATCAACGACGTGTGACCA-3'
H63 P2 18 bases 5'-GTCCGTGCTAGAAGGAAA-3'
H63 5' allele specific primer 17 bases 5'-TGTTCGTGTTCTATGAT-3'
H63 3' allele specific primer 15 bases 5'-GGCTCCACACGGCGA-3'
C282 Normal P1 28 bases 5'-/56-FAM/ TCATTCGCAATCACGGCCCGATAACTGA-3'
C282Y Mutant P1 28 bases 5'-/5Cy3/ TCATTCGCAATCA CGGGCTGAGGTAGAA-3'
C282 P2 15 bases 5'-AGGCGCGAGTGTAAA-3'
C282 5' allele specific primer 15 bases 5'-GGGTGCTCCACCTGG-3'
C282 3' allele specific primer 14 bases 5'-GCAGAGATATACGT-3'