Skip to main content

Table 1 Primers used in the study.

From: TGF-β induces the expression of SAP30L, a novel nuclear protein

Primer Sequence (5'→3') Method Company
FLJforward CCCAAGCTTGGGGCGGGGAGATGAACGGCTTC EGFP-PCR Genset Oligos
FLJreverse CCGGAATTCTCAAGCTGCTTGCCACCCTCCGA EGFP-PCR Genset Oligos
EX1S AGCACGGAGGAGGACAGCCGCGAA Sequencing Genset Oligos
EX2S GTAAGGCACCTATATATCTGTGAT Sequencing Genset Oligos
EX2AS GTGTCGTGCTCGGGAGAATCTCCG Sequencing Genset Oligos
EX3S GTTGATCTGTTCCAGCTGCAGGTG Library screening LightCycler
Northern probe
Genset Oligos
EX3AS TTCTGCTAACTGGGCCTTATTGAA Sequencing Genset Oligos
EX4AS TCAAGCTGCTTGCCACCCTCCGA Library screening LightCycler
Northern probe
Genset Oligos
3G3TNLSfor CGAAATAAAAGTAACAGGAAGACAAGT NLS mutation TAG Copenhagen
3G3TNLSrev ACTTGTCTTCCTGTTACTTTTATTTCG NLS mutation TAG Copenhagen
  1. The table indicates the names and sequences of the primers used in given experiments.