Skip to main content

Table 1 Oligonucleotide sequences for real-time PCR based DNA copy number determination (GCN) and gene expression analysis (GXP): Primer sequences for known genes are submitted to RTPrimerDB [37, 38]. Proper DNase treatment (see Methods) allows the use of intra-exonic primer pairs for both DNA and RNA profiling (F: forward primer; R: reverse primer).

From: Combined subtractive cDNA cloning and array CGH: an efficient approach for identification of overexpressed genes in DNA amplicons

APPLICATION GENE/CLONE PRIMER SEQUENCES (5' > 3')
GCN MYCN   RTPrimerDB ID 11
GXP MYCN   RTPrimerDB ID 180
GCN DDX1   RTPrimerDB ID 12
GXP DDX1   RTPrimerDB ID 93
GCN NAG   RTPrimerDB ID 13
GXP NAG   RTPrimerDB ID 114
GCN + GXP g10e3 F CTTTTCCTAAGAGCAAGGAAACAGA
   R CTGTTATTTAAAGAAACCAGCATTCACT
GCN + GXP g9d9 F CTTTGGCCAGTTCCACAGTTC
   R CACACCCAGCCTTAAGTTTTTGA
GCN + GXP NSE1   RTPrimerDB ID 715
GCN + GXP g10d12 F ACCTTCCATCCACACCTATGCT
   R TTTCATTCAGTTCAGTCTTCATCGA
GCN + GXP DNMT3A   RTPrimerDB ID 713
GCN + GXP TEM8   RTPrimerDB ID 712
GCN + GXP BMP10   RTPrimerDB ID 717
GCN + GXP PLEK   RTPrimerDB ID 716
GCN + GXP PPP3R1   RTPrimerDB ID 718
GCN + GXP g4d5 F AGATGCCCATTTCATCTCTCTTG
   R TGCTACAGGTCTTGCATTATCAAAC
GCN + GXP ETAA16 F   RTPrimerDB ID 714
GCN + GXP MEIS1   RTPrimerDB ID 690
GCN + GXP g2h10 F TTCCTGATGCCCACAAAGTTTA
   R ACACAAACTCTGAAAGCCAACTAATTT