Skip to main content

Advertisement

Table 1 Probes and primers used in TaqMan® analysis

From: Comparing gene discovery from Affymetrix GeneChip microarrays and Clontech PCR-select cDNA subtraction: a case study

Accession Number Gene 1) Probe
   2) Forward primer
   3) Reversed primer
AB017568 USF1 1) TCAACAACTGGATCGTGCAGCTCTCC
   2) TCGCCGCCGAGACAAG
   3) TCCATAGAGCAGTCTGGGATTATCT
AL050134 CDNA DKFZp586K011 1) ACCTGATTGCCAAAGACCGTTTC
   2) CATGTGCTTCGGATCCATGTAT
   3) GGGTCTGACTTGCCCTTCAC
AF177765 Toll-like receptor 4 (TLR4) 1) ATGATGCCTTTGTTATCTACTCAAGC
   2) GCATAAAGTA TGGTAGAGGTGAAAACAT
   3) TCATTCCTTACCCAGTCCTCATC
V00572 phosphoglycerate kinase 1) ATCTGCTTAGCCCGAGTGACAGCCTCA
   2) GTGGTCCTGAAAGCAGCAAGA
   3) CCCCACAGGACCATTCCA
NM_002046 GAPDH 1) CAAGCTTCCCGTTCTCAGCC
   2) GAAGGTGAAGGTCGGAGTC
   3) GAAGATGGTGATGGGATT TC