Skip to main content

Table 1 Putative alternate splice variants of MYB and RT-PCR results testing their existence.

From: Genome annotation of a 1.5 Mb region of human chromosome 6q23 encompassing a quantitative trait locus for fetal hemoglobin expression in adults

Putative Alternate exon Literature Existing sequence EST Evidence Ensembl transcript Gene Prediction Conserved region with mouse RT-PCR primer sequences: Positive result by RT-PCR (PCR conditions) Sequence Accession Number

2.5 mM/60C
8-extended [23] M13666     F: AAATATAGTCAATGTCCCTCAGCC

1.5 mM, 60C

2.5 mM, 65C
9Aii [21,22] X17469, X52126, U22376   F: AAATATAGTCAATGTCCCTCAGCC

1.5 mM, 62C

2.5 mM, 55C

1.5 mM, 60C

2.5 mM, 50C
  1. The putative alternate splice variant is indicated in the 1st column, and the subsequent columns indicate lines of evidence that suggested the existence of this splice variant. The literature references and accession numbers for previously reported splice variants are provided. Ensembl transcripts were observed on the v.9.30a.1 (2/12/2002) Ensembl release. Gene predictions were suggested by Genscan, Fgenesh++ or Twinscan, and conserved regions were classified as intronic sequence of >70% homology over 100 bp with the syntenic mouse region. The RT-PCR primer sequences used to test the existence of each alternate exon are listed, followed by a column indicating whether this splice variant was detectable by RT-PCR, and the associated PCR conditions. The final column provides the accession number of our sequences for the confirmed alternate splice variant.