Skip to main content

Table 2 Primer sequences used for RT-PCR analysis of novel chicken β-defensins

From: A genome-wide screen identifies a single β-defensin gene cluster in the chicken: implications for the origin and evolution of mammalian defensins

Gene Primer Sequence Product Size (bp) Cycles Used
  Sense Antisense cDNA Genomic  
Gal4 CATCTCAGTGTCGTTTCTCTGC ACAATGGTTCCCCAAATCCAAC 321 899 36
Gal5 CTGCCAGCAAGAAAGGAACCTG TGAACGTGAAGGGACATCAGAG 300 1100 36
Gal6 AGGATTTCACATCCCAGCCGTG CAGGAGAAGCCAGTGAGTCATC 249 1203 36
Gal7 CTGCTGTCTGTCCTCTTTGTGG CATTTGGTAGATGCAGGAAGGA 230 665 35
Gal8 ACAGTGTGAGCAGGCAGGAGGGA CTCTTCTGTTCAGCCTTTGGTG 261 967 35
Gal9 GCAAAGGCTATTCCACAGCAG AGCATTTCAGCTTCCCACCAC 211 1802 33
Gal10 TGGGGCACGCAGTCCACAAC ATCAGCTCCTCAAGGCAGTG 298 2285 33
Gal11 ACTGCATCCGTTCCAAAGTCTG TCGGGCAGCTTCTCTACAAC 301 1299 33
Gal12 CCCAGCAGGACCAAAGCAATG GTGAATCCACAGCCAATGAGAG 335 731 36
Gal13 CATCGTTGTCATTCTCCTCCTC ACTTGCAGCGTGTGGGAGTTG 175 4514 50
GAPDH GCACGCCATCACTATCTTCC CATCCACCGTCTTCTGTGTG 356 876 30