Skip to main content

Table 4 Specific primers used to assess quality and absence of DNA contaminants of the RNA samples, and randomly selected primers used to generate cDNA profiles.

From: The use of Open Reading frame ESTs (ORESTES) for analysis of the honey bee transcriptome

Primer code Sequence
actin F (Apis) 5' AGCTATGAACTTCCAGATGGT 3'
actin R (Apis) 5' CCACATCTGTTGGAAGGT 3'
16S mitochondrial F (Apis) 5' TTATTCACCTGTTTATCAAAACAT 3'
16S mitochondrial R (Apis) 5' 'TATAGATAGAAACCAAYCTG 3'
16S mitochondrial F (Drosophila) 5' CCGGTCTGAACTCAGATCACGT 3'
16S mitochondrial R (Drosophila) 5' CGCCTGTTTAACAAAAACAT 3'
p3_2 5' TTGGGGATCGTATGTAGTATG 3'
pA82_1 5' CACTTCAGGATCCCTTGTAAGC 3'
pA82_2 5' CCAACATTGAATTCTCTTTGAC 3'
pA82_4 5' CAATAACAATGAATTCCAGAATCTCG 3'
pPT7C4_B 5' GCTTACAAGGGATCCTGAAGTGTTTCC 3'
pPT7C4_XS 5' GCAGGTAAACTCTACTCGAGTTACG 3'
M-RON-AS 5' CCAGGATGTTTGGGTGATGTA 3'
CREB-S 5' TCATGCAACATCATCTGCTCC 3'
H-SPARC-S 5' CTAACCCAAGACATGACATTC 3'
M-CD151-S 5' AAAGCTCGGAGGCAGCGAACT 3'
H-CD151-AS 5' CATGTGGCTGCAAGGCAAAGC 3'
M-SPARC-AS 5' GCCCAATTGCAGTTGAGTGAT 3'
M-ETS1-AS 5' GTCTTGATGATGGTGAGAGTC 3'
FUT-3-S 5' TCATGTCCAACCCTAAGTCAC 3'
FUT-3-AS 5' TCCAGCAGGCCTTGCAGAAAT 3'
M-CMET-S 5' TATCTCAAACGATCGAGAGAC 3'
M-CMET-AS 5' GCACATCTATTACCAGCTTTG 3'
H-CMET-S 5' TTTCAAATGGCCACGGGAC 3'
H-CMET-AS 5' GCACATTTATGACCATTCTCG 3'
H-Rhoc-AS 5' AGAAACAACTCCAGGGGCCTG 3'
M-Rhoc-AS 5' CTACCCAAAGCAGAAACCCCA 3'
H-Sparc-AS 5' CCAAAACCATCCTTGACAACA 3'
H-RON-AS 5' TGATGAGGTCCTTCACGGTG 3'
B237-2 5' CGGAATTCACCAGATTTGAACAGAAGAG 3'
B237-3 5' AACTGCAGTTAACCAGATTTGAACAGAAA 3'
GST_(PGEX)_NHE_I-S 5' CCGCTAGCATGTCCCCTATACTAGGTTA 3'
HOXA_I-F 5' CGCTCCCGCTGTTTACTCT 3'
P21-RasaI-F 5' GACCGCTCCTCCAACTAACC 3'
P21-RasaI-R 5' CCGGCCCACCTCTTCTACTA 3'
SRY8299.2 5' TCTCTTTATGGCAAGACTTACG 3'
SRY1532.1 5' TCCTTAGCAACCATTAATCTGG 3'
92R7.2 5' GCCTATCTACTTCAGTGATTTCT 3'
TAFIEX.1R 5' ATCCAAGGTTCTCCCAATA 3'