Skip to main content

Table 2 Primers used in this analysis.

From: Comparative analysis of expression of histone H2a genes in mouse

Transcript Sequences (5' to 3'), forward and reverse Product size (bp)
Hist1h2aa cggcagtgctagaatacttgaca, gcaggtggcgaggagta 96
Hist1h2ab gcctgcagttccccgta, atctcggccgtcaggtactc 121
Hist1h2ac ggctgctccgcaagggt, cttgttgagctcctcgtcgtt 191
Hist1h2ad/2ao tggacgcggcaagcagggt, agcacggccgccaggtag 162
Hist1h2ae accggctgctccgcaaa, tgatgcgcgtcttcttgttgt 144
Hist1h2af cgaggagctcaacaagctgt, ttgggcttatggtggctct 111
Hist1h2ag tggacgcggcaaacagggc, cagcacggccgccaggtaga 162
Hist1h2ah atatgtctggacgcggt, acgcgctccgagtagttg 133
Hist1h2ai/2aj tcgcgccaaggccaagact, cccacgcgctccgagtagtt 102
Hist1h2ak tacctggcagccgtgcta, cagcttgttgagctcctcgtc 141
Hist1h2an gaggagctcaacaagctgct, ggtggctctcggtcttcttc 100
Hist2h2aa1/2aa2 aactgtagcccggcccg, ttcgtctgtttgcgcttt 100
Hist2h2ab/2ac ggcaaagtgacgatcgca, gtggctctcggtcttcttgg 78
Hist3h2a agcagggcggcaaagctcgt, ttacccttacggagaaggcg 100
H2afx aaggccaagtcgcgctctt, tcggcgtagtggcctttc 86
H2afz actccggaaaggccaagaca, gttgtcctagatttcaggtg 100