Skip to main content

Table 2 Transcript level comparison of P. aeruginosa genes between real-time PCR analysis and microarray analysis

From: Microarray analysis of Pseudomonas aeruginosa reveals induction of pyocin genes in response to hydrogen peroxide

Gene mRNA level change Sense primer sequence (5'-3') Antisense primer sequence (5'-3')
  real-time PCR microarray   
PA4613 1.69 (± 0.44) 4.54 GAGCAGAACTTCAAGCAGAC CTCTCGTCGTCGGTGATC
PA2850 -1.64 (± 0.19) -1.37 GAGGTCGAACTGCACATC GGGTAGCGTTGGAGTAGG
PA4763 4.24 (± 0.17) 8.27 GGAGCAGGAGCAGAAGAC GTTGAGGCTGGCATTGAG
PA5530 34.26 (± 7.17) 24.70 AAGAAGGAAGAGCCGAAGG ATGTAGGTGGTGTAGGTGTAG
PA0576    CGTCCTCAGCGGCTATATCG TTCTTCTTCCTCGTCGTCCTTC