Skip to main content

Table 1 The coding envelope genes of the human genome studied for their SNPs.

From: Comprehensive search for intra- and inter-specific sequence polymorphisms among coding envelope genes of retroviral origin found in the human genome: genes and pseudogenes

Gene name Bibliographic gene name Family name (repbase identifier) Approximate number of elements Genomic localization Amplification primers sequence (5'-3')
env K1 - HERV-K(HML-2) (HERVK) 50–100 Chr12: 57008431–57010527 (-) F: GGGAAATAGGGAAGGTGATA
R: ACATCCCTAACGCTTTAAG
env K2 HML-2.HOM, HERV-K108 idem idem Chr7: 4367317–4369416 (-) F: GAGGTTTTGCTTGTGTTTCA
R: TTAGGCTTTCGGGACTTCAA
env K4 HERV-K109 idem idem Chr6: 78423172–78425268 (-) F: GGGAAATAGGGAAGGTGATA
R: GGGTAGTATCAGTCGGGATG
env F(c)1 - HERV-F(c)1 (-) 1 Chr:X: 95874118–95875872 (+) F: GCACCGACTCAGCACGAC
R: GCCTTGGCAACTAAACCATTC
env F(c)2 - HERV-F(c)2 (-) 15 Chr7:152498167–152499936 (-) F: GAAGGCACCTACACAACATC
R: GACACTTAATAGTTGCGACA
env H1 envH/p62, H19 HERV-H (HERVH) 1000 Chr2: 166767244–166768998 (-) F: ATGCCCTACTCTTGTTTACAC
R: AAATCTGGCAAACTACAAGC
env H3 envH/p59 idem idem Chr2: 155931277–155932944 (+) F: TTTCTTCAAGCCATCACAGC
R: ACCCCATGTTCTAGTCTTCC
env T - HERV-T (HERVS71) 50 Chr19: 20341241–20343121 (+) F: TTGGATTCATCACTCCCA
R: CTGAAGGGAGTTCCTCCTAGG
env W Syncytin 1 HERV-W (HERV17) 200 Chr7: 91710108–91711724 (-) F: AACAACCAGGAGGAAAGTAA
R: CTGATCAAGTCGCAAAGC
env R erv3 HERV-R (HERV3) 100 Chr7: 63863079–63865094 (-) F: GGTTAGAAATCTGAAGTCC
R: AAAGTCAATGACAGATGCGG
env R(b) - HERV-R(b) (PABL_B) 50 Chr3: 16786814–16788358 (+) F: GCTAAGCACCAGTTCAGCACTG
R: TGTTTTGGGACACCACGAAT
env FRD Syncytin 2 HERV-FRD (MER50) 3000 Chr:6: 11211913–11213529 (-) F: CTTGTACACCACCAGGAGTTCC
R: TTTGAGCAAGGGTGATTCAT