Skip to main content

Table 1 Information on new primers for genes annotated by PCR

From: Comparative analysis of a BAC contig of porcine chromosome 13q31-q32 and human chromosome 3q21-q22

Gene Forward Primer (5'- 3') Annealing temperature
Porcine Acc.No. Reverse Primer (5'- 3') Amplicon size
H41 GGCAAGAGTGAAGCAAATGG 60°C
AY518265 TCAAAAACATAACCCCAGCAA 395 bp
TOPBP1 CCTGAATCTCTTTATCCACATACTT 57°C
AY518266 CATTTGATGGTGCTGACTCTT 318 bp
PICA TGGACGCGAAGCTCTAT 59°C
U36916 TCCGAGTTACAATTCAAGATG 1.286 bp
TF (exon 2) CCAATAAGTGCTCCAGTTTC 56°C
X12386 CCCTGATGGCTTTGATG 111 bp
SRPRB CGCCTTCCATCCCTACCT 58°C
AY518267 AACCGCCCTTTGACTGCT 756 bp
RAB6B CATTGGGATTGACTTCTTGTC 58°C
AY518268 GATGTAGCTGGGGATCAGG 313 bp
SLCO2A1 (exon 3) GCCGTCCTCATCATCTTTGT 60°C
DQ104835 GAAGTGCGGGAGGGTGA 117 bp
SLCO2A1 (exon 9) CCTTGGGGATGCTGTTTG 60°C
DQ104841 TGGAGATGGTGATGATGGTG 96 bp