Skip to main content

Table 3 Oligonucleotide primer sequences for qRT-PCR validation of microarray results

From: Construction and validation of a Bovine Innate Immune Microarray

Gene name (Symbol) Accession number Forward Reverse Amplicon size (bp)
Acidic Ribosomal Protein Large P0 (RPLP0) NM_001012682 CAACCCTGAAGTGCTTGACAT AGGCAGATGGATCAGCCA 220
Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) AF077815 CCTGGAGAAACCTGCCAAGT GCCAAATTCATTGTCGTACCA 226
Tumour Necrosis Factor alpha (TNF) NM_173966 CTGGTTCAGACACTCAGGTCCT GAGGTAAAGCCCGTCAGCA 183
Interferon gamma (IFNG) NM_174086 GTGGGCCTCTCTTCTCAGAA GATCATCCACCGGAATTTGA 234
Chemokine (C-C motif) ligand 3-like 1 (CCL3L1) NM_174511 GGTCTTCTCGGCACCATTT CCAGGTCGGTGATGTATTCC 209
Interleukin 2 receptor alpha (IL2RA) NM_174358 ACCATGATAAACTGCGACTGC GGTTGGTAAGAAAGTTCCACTCC 513
Tumor Necrosis Factor Receptor Super Family Member 9 (TNFRSF9) NM_001561 AAATCCTGCAGTGATCGTGTCC CTTCTTCAGCAGCCCTGGAAT 189
Thrombospondin (THBS) NM_174196.1 CCAATCCTGACCAGAAGGAC TGGCGTACAACCCAGTTAGG 202