Skip to main content

Table 3 List of primers for RT-PCR

From: The stress response against denatured proteins in the deletion of cytosolic chaperones SSA1/2 is different from heat-shock response in Saccharomyces cerevisiae

Gene name Forward primer (5'-3') Reverse primer (5'-3') Product size (bp) No. of cycles
PRE1 TGACTTCCAGGCACAGTGAA TCTCACTCTGCCAACAAAAA 187 25
RPN4 CGAAGCATGAAGATTTGTCG AAGAACATTCCTGAATGCAGAT 202 25
RPN12 CCAATCAAAGGAGAAAGCTGA CTCCGGGAGAGAAAAAGTTG 178 22
SCL1 AGTCGGTGTCGCTACAAAGG CGACAAAAGGGCTTGAAAAG 229 20
UBC4 CAGCCAGAGAATGGACAAAGA AGGTTCCCCTGTACTGTTGC 220 20
KAR2 GTTCTGGTGCCGCTGATTAT CGAAAATTGTATGAAGCTCGAA 205 20
RPS15 AGAGCCGGTGCTACTACTTCC CGTGTACAACCCCCATTCAC 200 22
RPL25 CGTTACCAAGAAGGCTTACG CGTGCACTCTGCCACTACAC 203 22
RPL37A CAAACCGGCTCTGCTTCTAA TTCCCGTAAGCACTCAAAGG 194 25
ACT1 CCTTCCAACAAATGTGGATCT CAGTGCTTAAACACGTCTTTTCC 200 25