Skip to main content

Table 1 Hybridization of single-copy gene probes on high-density membrane

From: Construction and characterization of a genomic BAC library for the Mus m. musculus mouse subspecies (PWD/Ph inbred strain)

Gene/Primer GenBank accession/Primer sequence Genomic position1 Length Positive clones
Mash NM_008554    
mMashCgi-F ACCCGGTTCCTCGCGAGCACTTTTC chr7:130,673,330 358 bp 5/48
mMashCgi-B AGCGCAGCGTCTCCACCTTACTCAG chr7:130,672,998   
Adseverin NM_009132    
CpG-Ads-1F TCTTGGAGGGTCATACTCATT chr12:35,153,275 516 bp 7/48
CpG-Ads-1R GCAGCTCAAAATAATTACGAC chr12:35,152,780   
Igf2r NM_010515    
Igf2r-H4F TCAGAACACTGGTGAGCAGTGGG chr17:12,150,732 244 bp 11/48
Igf2-H4R GAGGGTAGGATTCCGTTGCAAGG chr17:12,150,509   
Tbp NM_013684    
  * probe derived from tbp-1942 clone chr17:14,324,440 1085 bp 4/48
   chr17:14,334,524   
Usp26 NM_031388    
Usp26-A AATGTAACGAAGGGAGAAGTG chrX:44,101,298 206 bp 3/48
Usp26-B AGGCTTTGCCTTCTTATCGAG chrX:44,101,113   
Xist AY618354    
mXistF AGTGGGTGTTCAGGGCGTGG chrX:94,885,925 293 bp 11/48
mXistR CTATCCCCTAGTCCTCTGCGG chrX:94,885,652   
Tex13 NM_031381    
Tex13 pub-1F ACCAGAGTTGGGAACAACTAA chrX:130,816,501 220 bp 7/48
Tex13 pds-1R CTGTTGTAGAGGGTAGAGGTT chrX:130,816,302   
  1. 1 mm5 assembly, UCSC