Skip to main content

Table 3 PCR primer sequences used to amplify DNA (D) or cDNA (C) templates for mutation screening. The order of the amplicons listed is the same as in Table 1.

From: Efficient gene-driven germ-line point mutagenesis of C57BL/6J mice

Gene symbol Amplicon size (bp) Template Forward primer (5' to 3') Reverse primer (5' to 3')
Mc1r 579 D gaggatccttcctgacaagactatgtcca aacggctgtgtgcttgtagtagg
Mc1r 446 D tcgtctccagcaccctctttatc gagtcgacgatcaccaggagcacagcagca
Mc1r 527 D gcacacttctaatggagagtg ggctcaggtagagacatgcc
Zfp111 352 D ccagagagaaataatgcccc caagaaccctgggctctcc
Zfp111 327 D ggttcagtcaggtctcacac caggattgatataatgctcc
Scnm1 394 D aggcacagcgtctcaaagtattgt atagggtagtaggggtcaccactc
Scnm1 484 D ggcaagaagcatttgtccagtaag tttctcagaatacaatctggagagc
Scnm1 372 D tgagttcccgtcagccaggacttc ctcactcaccttcggagggtaagg
Usp29 300 D ccttactcatcgacaagttatc tggaggaggatggttctgtctt
Usp29 336 D gggtctgctggcaccaaaaggt ggcaacaagtcagtggtaact
Usp29 298 D gggtcttcaagaggttccagag gagcctgtaattctgaagatca
Zim1 298 D ggaagaagacaggggataattcc ggagcgctctgtggtgttgtag
Zim1 298 D atcttcgggtcaaacatcagca gtagtgtgtgaggaagtatgaga
Zim1 302 D tggagagtgtaacaagtgcttc ggtgcttgagaagggctactttg
Zim1 302 D cccggagtgtgggaaagtcttc ggtgaatcagcagggtagccagt
Myd88 429 D ggctggcaggagacttaagg caggaagcacgtttcctcac
Myd88 196 D cacccttctcttctccacag gcccacctattctacctagg
Myd88 497 D ccttctgcagaggctgattg ccaaagcaggcctaagcttac
Myd88 245 D cgtggtcctaataccacacc ggaggcaagcggaagaacac
Ap2s1 424 D gccttgtctgtacctgtctc ggacgagcaggcaggttggtc
Capsl 372 D gaggtaaacctagggcttctg ctgccacgctgtcaataccg
Capsl 344 D gcacatgcatttctccatgg gctttgtaaggctctgaacc
Antxr1 419 D gagaatgggagatgaagttgg gttcacctagcactttgtgg
Antxr1 335 D catatggctgtcaacagcaagg gagtgtcggttaaggagaag
Antxr1 157 D gacgatctccaaagattcgg gtaggactctgtggctgatg
Antxr1 363 C gttctgccaggaggagacac gcagatggtggatggttcag
Antxr1 490 C aggctctccaaggcattatcc ccatcatcgtcttcttcctcac
Antxr1 489 C gctgctctggtggttctg gtgttgttcaggggatacttg
Ap2a1 510 C agaacgctatcctctttgagacc ggacgtcatcacggttgg
Ap2a1 543 C ggcttttgctgcagacattc aggttgggctcactgtcatag
Ap2a1 442 C gttgtcggtgcgcttcc catataccagggcaagtccag
Ap2a1 531 C ctatgtgagcgaggaggtgtgg cggctgtcatctagggcactg
Ap2a1 351 C agcgggagtcgtccatcttg gagctgggtcagccaacaaag
Pak4 503 C aacacatacccacgggctgac cgcatgatcaccacctcattg
Pak4 477 C gtacgcgggcacagagttc ccgacatgttctcaaattcgtc
Pak4 459 C aggatggggctctcactctg cattaggggccatggtatgtg
Pak4 412 C caagcagcaaagacgtgaaactg atagggaaggcgggagatgag
Pak4 447 C ctgtccgacttcgggttttgtg gtagccaggctctttggttcaagac