Skip to main content

Table 1 Sequence and parameters of the reference and 22q11.2 test primer sets. Ten sets of primers were designed from within regions of unique sequence on 22q11.2 using Primer Express v2.0. In addition, two sets of reference primer for G6PDH and HEM3 were also designed to allow for data correction.

From: A method for accurate detection of genomic microdeletions using real-time quantitative PCR

Primer Sets No. Primer Name Primer Sequence Chr. Genomic Location of Amplicon Amplicon Size (bp) Cycle Treshold Slope R2
Reference 1 G6PDH-F TCTTCATCACCACAGAGAACTTGC 1 9033513–9033733 221 0.2 -3.2968 0.9980
   G6PDH-R GACCTGGAAGTCACTGGGCA       
  2 HEM3-F TGCACGGCAGCTTAACGAT 11 118501618–118501818 202 0.2 -3.3998 0.9981
   HEM3-R AGGCAAGGCAGTCATCAAGG       
Test 1 D22S181-F CAGCTCCCAAGTCTTTCCAGC 22 16968759–16968859 101 0.2 -3.4141 0.9986
   D22S182-R CCAGGGTAGGAAACAGGTCGA       
  2 PRODH-F GGGAAAGGAGAGTTCAGGCAG 22 17293217–17293317 101 0.2 -3.5102 0.9992
   PRODH-R GCTTGTTGAATAGCCTCTGTCCTAG       
  3 TUPLE1-F GGCAAGTGCAATATTCATGTGGT 22 17763150–17763250 101 0.2 -3.2564 0.9996
   TUPLE1-R TCCTACACGCCTGACAAAGCT       
  4 COMT-F GTGCTACTGGCTGACAACGTGAT 22 18330640–18330739 100 0.2 -3.5876 0.9928
   COMT-R GGAACGATTGGTAGTGTGTGCA       
  5 ZNF74-F TGGCCTCCTGCTTCTTTCTTC 22 19073892–19073992 101 0.2 -3.2263 0.9960
   ZNF74-R CAGACACTCCAATTCATGACGAA       
  6 PIK4CA-F ATGCTTGTGCGACGCAGAC 22 19429805–19429905 101 0.06 -3.0238 0.9958
   PIK4CA-R CCTCAGCCATGTTGACTCAGC       
  7 LZTR1-F TCATCATGGATGTGTACAAACTGG 22 19673422–19673524 103 0.2 -3.2416 0.9977
   LZTR1-R AGCACGTTCTGCAGGTCCAC       
  8 CAT4-F TACCTGGGCTTCTTGGATGG 22 19708684–19708784 101 0.2 -3.4394 0.9986
   CAT4-R AAGACAAGCACGCAGCCTATG       
  9 D22S936-F TGGCAGCCAGTTTAGTATTCTGC 22 19777314–19777414 101 0.2 -3.1972 0.9960
   D22S936-R TTGTAATCAAGTCCCGCCACT       
  10 VPREB1-F CGACCATGACATCGGTGTGT 22 20924000–20924102 103 0.2 -3.2923 0.9972
   VPREB1-R CTGGCTCTTGTCTGATTGTGAGA