Skip to main content

Table 1 Primer positions and sequences

From: Transcription of the human and rodent SPAM1 / PH-20 genes initiates within an ancient endogenous retrovirus

Primer namea Exon Sequence (5'-3')
HGF1 6 CATGAGAAGTATGACAACAGCCTC
HGF2 8 TGGTCTCCTCTGACTTCAAC
HGR1 9 GTTGCTGTAGCCAAATTCGTTGTC
HGR2 9 CTGTAGCCAAATTCGTTGTC
HSF1 4 CTACACTCTATGTGCGCAATCG
HSF2 1A TAGCAGTGTAGGTGGTTAGCAG
HSF3 1B GGGTCTAATTGACTTGAGAATGTG
HSF4 4 TTTTTGCATATACCCGCATAG
HSF5 1A-3 TCCTTCCTAGCAAGGGATG
HSF6 1B-3 AAAAAATTAAGCTGAAATGGATG
HSR1 6 TTTGGCTGCTAGTGTGACGTTG
HSR2 4 CTGATGCAAAGTATGAGCACAG
HSR3 4 CATTCCAGGCCCAGAGGAAAG
HSR4 5 CCCATATTACAATTCCAGAAG
HSR5 3 AAGTCTGCTTTCAAAATCCAG
MGF 3 GTGGAGTCTACTGGTGTCTTC
MGR 5 GTGGCAGTGATGGCATGGAC
MSF1 4 GATGCTATGAGTTTAGCACAACG
MSF2 1 ATGATGGAGATGCGAGTGGTAG
MSR1 5 CATCAGATGTCTCCTTACATGTC
MSR2 3 TGTGGTCTGTTTAGTATTAGATGC
MSR3 3 TTCCTTCTTACACACTGTGGTC
  1. a) H, human; M, mouse; G, GAPDH; S, SPAM1; F, forward; R, reverse.