Skip to main content

Advertisement

Table 1 List of the PCR primers used.

From: Colour variation in red grapevines (Vitis vinifera L.): genomic organisation, expression of flavonoid 3'-hydroxylase, flavonoid 3',5'-hydroxylase genes and related metabolite profiling of red cyanidin-/blue delphinidin-based anthocyanins in berry skin

Target DNA Name 5'→3' sequencea
Plant F3'H F3'H_S CCIGTIAANYTNGGNCARYTIBTIAA
Plant F3'H F3'H_AS GCICKYTGIARIGTNARNCCRTA
Plant F3'5'H F3'5'H_S ATGCTGACNTAYGCIATGGCNAAYATG
Plant F3'5'H F3'5'H_AS CGAARTCRTTICCYCKNGGNTCDATYTT
Grape F3'H VvF3'H_S ATTCGCCACCCTGAAATGAT
Grape F3'H VvF3'H-indel_S CAACAAGAGCTGGACGCAGT
Grape F3'H VvF3'H_AS AGCCGTTGATCTCACAGCTC
Grape F3'5'H Vv3'5'H-1A_S GAAGTTCGACTGGTTATTAACAAAGAT
Grape F3'5'H VvF3'5'H-1A_AS AGGAGGAGTGCTTTAATGTTGGTA
Grape F3'5'H Vv3'5'H-2A_S AAGAAGTTCGACAAGTTATTGACAAG
Grape F3'5'H Vv3'5'H-2A_AS AGCGCCTTAATGTTGGTAAGG
Grape F3'H VvF3'H-intron_S CGTTGATCTCGCTGAAGGAT
Grape F3'H VvF3'H-intron_AS ATCATTTCAGGGTGGCGAAT
Grape F3'5'H Vv3'5'H-1A-intron_S GCTCACTATTACCAACATTAAAGCA
Grape F3'5'H Vv3'5'H-2A-intron_S AAGCTCACCCTTACCAACATTAAG
Grape F3'5'H Vv3'5'H-intron_AS GGCAAGTCAGACTCCACGAG
BES38C24-FM 38C24-FM_S TGGCCTTCATTTTGGTTAGC
BES38C24-FM 38C24-FM_AS TCATCACTCAGGGCACAAAA
BES38C24-RM 38C24-RM_S TTACCGCCCTTGTCCTTGTA
BES38C24-RM 38C24-RM_AS GCGTATTGATCATCCCTTGG
BES17K4-FM 17K4-FM_S CCAATATGTGGAGGAGGAACA
BES17K4-FM 17K4-FM_AS CATCCAGGTTGTGAAGGACA
BES9C17-FM 9C17-FM_S AGGAGGCCTATGCATCAGAA
BES9C17-FM 9C17-FM_AS GGAGCACCATTAAAGGCAAA
BES40A22-FM 40A22-FM_S CTAATGGGCATCAGGTTTCG
BES40A22-FM 40A22-FM_AS CGTGCATATCATTTTCTTCCAA
BES5A23-FM 5A23-FM_S TTCAAGAAGTGGAGGCTGCT
BES5A23-FM 5A23-FM_AS AGCACTGACTGCCTGATCCT
  1. a Degenerate IUB code: I = inosine; R = A or G; M = A or C; W = A or T; Y = C or T; S = C or G; D = A, G or T; N, A, C, G or T.