Skip to main content

Table 2 Primer information. Primers used to assess the CNV14q12 and RP11-79B13 genomic regions.

From: Large scale copy number variation (CNV) at 14q12 is associated with the presence of genomic abnormalities in neoplasia

Primer Accession Sequence Size Conc.
125A5_F AQ345961 AGCATGTCCCTCTCTCAACC 118 bp 50 nM
125A5_R AQ345961 GCAGCCTATAACCCCCTTTT   
79B13_F AQ284031 CAGGATGTCCACAGCCATAA 140 bp 100 nM
79B13_R AQ284031 TCTGTTGGGTCCTGAGGAAG