Skip to main content

Table 3 Sets of real-time RT-PCR primers and probes for detection of TRP ion channel transcripts

From: Tissue-specific expression of TRP channel genes in the mouse and its variation in three different mouse strains

Gene Accession number Sequence 5'-3'
TRPC3 NM_019510 for: CCAAGCTGGCCAACATAGAG
rev: GGCAAGTTTGACACGACTCA
probe: actcggaggaggtggaagccattc
TRPC4 NM_016984 for: TGGAGTGGATGATATTACCG
rev: CCACATGTCCCATGATTC
probe: TGTGATGAACTCCTTGTATCTGGCAACAA
TRPV1 NM_001001445 for: GCATCTTCTACTTCAACTTCTTCGTC
rev: CCACATACTCCTTGCGATGGC
probe: CAAACTCTTGAGGGATGGTCGCCTCT
TRPV5 NM_001007572 for: CAAGAAGAAAGAGGCTCGAC
rev: AATGACTGTCACCAACTCCC
probe: CCGTACACATGTTCGAGATAACACCATCA
TRPM2 NM_138301 for: CAGATCCCAACCTACATTGACG
rev: GAAGGTGTAGTTGAACATGGCGA
probe: ACCAGTGCAGCCCCAATGGCA
TRPM3 NM_177341 for: CAAAGATGACATGCCCTATATGA
rev: CTTTCTTTCTGGATGATTCCC
probe: ATGAAGAGGACATGGAGCTAACAGCAA
TRPM4 NM_175130 for: CCCTGAGGATGGTGTTGAGT
rev: AGGAGCACTGGGATGTCAAT
probe: CTTCTTGGTGGATGATGGCACC
TRPM6 NM_153417 for: CCAGGTGCCGGTAATAACA
rev: CTCTTGTGGCTGCCTTAGGT
probe: CAGTTGAATGCAGAGCCAGGAGAAAC
  1. The sets of PCR primers and TaqMan fluorogenic probes were obtained from TIBMOLBIOL.