Skip to main content

Advertisement

Table 3 Sequences of primers and TaqMan probes used for qRT-PCR

From: Clustering of Pseudomonas aeruginosa transcriptomes from planktonic cultures, developing and mature biofilms reveals distinct expression profiles

Primer or probea Oligonucleotide sequence 5'→3'
FliE F GGAAATGCGTTCCATGCAA
FliE R GGAGAGCATTTCCGAAAAGCT
FliE P TTCAGGCGCCGGCCGAAG
PA0020 F GCCGGCCTATGGCATCTT
PA0020 R GCGTTGATGCCGAGGACTT
PA0020 P CCAGGGCAAGGTCTACATCGATCCG
ClpP F GGTGGTTGCTCAGTTGCTGTT
ClpP R CGGCGAGTTGATGTAGAGATGA
ClpP P CTGGAGGCTGAAAATCCCGAGAAGGA
PA2184 F GCGCGGCTGGAACACTAT
PA2184 R CCATGGGTTTCCTCGATGTG
PA2184 P CGCAACTGAAGACGCGGATCGA
PA5555 F CGCTGGTGGCCGATGA
PA5555 R GGCGTCGGGTTCGTAGAGA
PA5555 P TCAGGAGCTGAAGCACCACTGGGACT
  1. a. Forward primers (F), reverse primers (R) and TaqMan probes (P) are displayed.