Skip to main content

Advertisement

Table 2 Poly-pu/py-rich sequence contexts of differences between humans and chimpanzees in human hot spot central regions. Differences between humans and chimpanzees within 166 bp of human hot spot mid points occurring in sequences at least 14 bp long consisting of over 80% poly-pu/py and at least 50% G/C. In each case, the hot spots are absent in chimpanzees. The chimpanzee sequence is shown in lower case.

From: Association of poly-purine/poly-pyrimidine sequences with meiotic recombination hot spots

Hot Spot References Sequence context Distance of difference from human hot spot mid point (bp)
Beta-Globin [15, 45] CCTTTTCCCCTCCTACCCCTACTTT(C/t)T 133
DMB 1 [4, 15] GGGGGTGAGCAACAG(A/g)AA 35
DMB 2 [4, 15] GAGAGGAGAGAAGTGGAGTGGGAGAAAGAAGGAGAG(G/a)GACATAGAGAGAGGGA(G/a)(G/a)GAGGGGAG(C/-)GG(-/a) GGGAAG/AGAGAGAGAGCTGGA 115, 98, 97, 88, 85
DMB 2 [4, 15] GGGAGGGGAG(G/t)TGGA 51
DNA 3 [4, 15] GGGAGGCC(A/g)AGG(C/a)GGG 23,27
TAP 2 [4, 15] (C/g)CTTCATTCCATCC 83