Skip to main content

Table 1 Sequences of PtMPKs 3'RACE and RTqPCR primers used for 3'UTR MAPK gene isolation and expression profiling.

From: MAP-ping genomic organization and organ-specific expression profiles of poplar MAP kinases and MAP kinase kinases

Group Gene name 3' RACE Primers (5' to 3') Forward RTqPCR Primers (5' to 3') Reverse RTqPCR Primers (5' to 3')
A PtMPK3-1 CCCACTTGTTCACCCTCTGGCCATTG CCATAAGCACTACCAGTCC TCA GATACAGAGGAGTGC
  PtMPK3-2 AGCATTGGCTCATCCATACCTTGCAAGG CTTTAGCACTACCAATCCCG TGAACAATTAGCAAGTCCAGG
  PtMPK6-1 TCCCAACTGTCCACCCGGCAGCTATTG CATTGTGACTGGTCAGCTTGA GTTCCCCTGAATTCTGTCC
  PtMPK6-2 GATCCCAGACAGAGGATTACTGTTGAGG ATGAGTCGACCAGCGTGGC CACTACATTGACGCCGATAC
B PtMPK4 AGTCGATGAGGCACTGTGCCATCCATAC TGGTGTGCAGTTGGGAAGG GAACCTTCATAGAGATTCTGC
  PtMPK5-1 TCGCATCACTGTTGATGAGGCCCTTTGT CGTCATTTCCTGGAGAATATG ACAATGCAATTCACTTCAGGC
  PtMPK5-2 CCCAATAACCGCATCACTGTCGATGAGG CATAACTTCTGACACATTTGGG CATACAACACATGATCCTTGC
  PtMPK11 GAGGCATTGTGCCATCCATACTTGGCAC GTTTGCTGAGCAGAATCTCC GCGTCCTCAAAACCATGAAG
C PtMPK1 CCGGAGCACTGGAACACCCTTACATGTC AAGAAGCACGCACAAGCCAG TACAAGCTGAAAGGGCCACC
  PtMPK2 GCTGCAACCCTCCAGCTCAGGTCCC GTGTGTTTTTGTACGTGTCTG AGAACTAGAAGCTCACTGCC
  PtMPK7 CAGGGCTGTACGATCCAAGACGCGACCC CTAGTGTGTCTGTGAGATCAG GGATGCCATAGTCCGGCTC
  PtMPK14 ACCCTTACATGTCAGGGCTGCACGATCC TGCACGATCCAAGACACGAC TGCGAAAACAACTTCTGGGTG
D PtMPK9-1 CCAGGGTCACAGCAACCAGATGGTTCAG GATTCAGATGGCTGCCTTTG ACAAGCTACTGCCTGATCTTC
  PtMPK9-2 GCAGCTCAAAGCACTGATATTGAGAGGC CCAGCGTAGTGTGGATAGTG TCACATCTCCTCTCTGCAATC
  PtMPK16-1 CGGTGCTGCGTTACAACAATTGTGGAGC AATCTGTGCCATTTTGTCTGTG TGGCCTTATGAATACAGCCAC
  PtMPK16-2 GTGGAGCAGCAGCAGCAGAGAATCTTGA CAGCAGCAGAGAATCTTGAC CCATTGGAACCTTCAACCAC
  PtMPK17 CTCTTTCTCGTGCAGCTAAGCAGAGCCC CCTATTTGCACATCTTGGAGG GCGGTAGTACATTTAGTGAGG
  PtMPK18 CCTCCCCAAACCAGCTCTCCACACCACTGCT GATAAATCCTTTCCACCCTCG GTTGACTACACCCTTGAAACC
  PtMPK19 CTGGGATGGCCATGGATGTGAACGCCTA GTTGGTATCACGATCAATTATG TGACTAGATACAGGACGTGG
  PtMPK20-1 GGGAGGGAGCAAGGAAGAACATGTGGAT GGACTGAGGAGATCCACTTG CCCCCTCTTTTTACACAATCC
  PtMPK20-2 GTGGCATGGCAGCCAAATATGCACCAGA GGTTGGAGCTGTTCAATATGG GACACGTTGATCTTCTGAGTC