Skip to main content

Table 1 Marker genes used in the TRAC analysis.

From: Transcriptional monitoring of steady state and effects of anaerobic phases in chemostat cultures of the filamentous fungus Trichoderma reesei

Gene name Length nt ORF no. Function Sequence
Pool1     
cbh1 25 22421 cellobiohydrolyase CATTCTGGACATAGTATCGGTTGAT
egl1 27 42363 endoglucanase CGGACTTTGTACACTTGTAGGTTGTCA
sod2 29 42675 Superoxide dismutase TTGATGACGTCCCAGATGGCGCTGAAGTA
pdi1 33 45146 protein disulfide isomerase GGTCAAAGGGGAACTTGAGGTTCTTCTCAATGT
gap1 33 43090 general amino acid transporter TGATACTTCCAGGCATTGCGGAATCGGATGTGG
axp1 33 21826 acidic extracellular protease AAGTTGAAGGTGGCATCCTTGATGTTTGCTTTG
trx2 39 9865 thioredoxin protein CAAACTTGACAAAGTGGACCTTGTCCTTGAACTCTGCGT
ccg9 39 43571 Clock controlled gene, cell wall biogenensis AAACTTTGACTTCGAACCCTTCATACGTCGACAGTTGAA
bgl2 41 42449 β-glucosidase CGTTATAGTACTTGACCCTGAAGTCATCTTCGAGAATCTTC
bga1 43 45191 β-galactosidase TTTGGAATGCCAATGATCTCGAGCGGCGTTGTGACGTTGAAAT
Pool2     
mca1 25 20144 metacaspase, cysteine protease, apoptosis AATACCCTGCGTGGAGTAGATGTAC
bip1 27 42955 protein chaperon AGGGGGTTGACGTCCATGAGAACAATG
aep1 25 46483 alkaline extracellular protease CATGGAGGTGCCGCTAATCGTGTTT
vpa1 27 44744 vacuolar protease A GTGATGTCGGGGAGGGAATCACGCTTG
hsp30 31 29985 heat shock protein GTACTTTGCGTTGTCGGTAGGCTTGTTGCTG
con6 31 35051 ligth induced conidiation gene TGCTTAGCGTTTTCCTTTGCTTCCTCCGACA
trr1 31 45052 thioredoxin reductase AATGACGAAGAGGGGCTTGTTGCGGAAGATG
gcn4 37 37844 transcription factor TGAAGAAGACGATCGGTACATGGGCTCTGATTCCAAA
chs1 37 43213 chitin synthase GAAAGAAGCGATAAAGTAGAGGCCGTAAATGGTAATC
nsf1 41 42584 general membrane fusion factor CAACAGGGCATCGTCAATCATGTCTTTTCGATTCGTCATTC
nth1 43 44650 neutral trehalase AACGTAACTGGCATTGACCCATCCAAATCCTTCTTTCGCAACG
ctaA 41 21112 ATPase copper transport ACGAGTGATTGTGCCGGTTTTGTCCAAGACGACTTTGGTAA
Pool3     
eno 25 43415 enolase TTACGGAAGTTGGTGCCAGCGTAGA
rpl16a 27 43406 ribosomal protein L13A, 60S subunit CAACCTTCTTGCGCTCGTAGTAGGCAG
gpd1 29 20456 glyceraldehyde-3-phosphate dehydrogenase ACGAAGTTGGGGTTCAGGGAGATACCAGC
hem6 29 13475 Coproporphyrinogen III oxidase, heme biosynthesis ACTTCTTGAACCGAGGGTAGTACGTCTTG
hsp70 33 27833 heat shock protein TTGGTGATGACAATCTTGTTGGACTTACCAGTG
hsp105 37 42578 ER chaperon CGGGCTTATCCTCAGTGTCAACTTGTTGATAGAATAA
rps16b 35 29002 ribosomal protein S16A, 40S subunit TGACACGGACGCGGATGTCGACGTTGGCGAACTTG
acs1 39 20403 acetyl CoA synthase TTGTGCTTCTCAATAATGTCCCAGTACCTTGAGAAGTTG
tps1 41 21151 trehalose-6-phosphate synthase AACTTGCGGATGAACTTGGTGATCCACGACTGGACATTCTG
  1. Oligonucleotide probes binding to respective mRNA targets are organised into 3 pools according to their migration in capillary electrophoresis.
\