Skip to main content

Table 3 Primers used for semi-nested RT-PCRs.

From: The SNARE protein family of Leishmania major

Primer name Primer sequence Target
OL1760 AACTAACGCTATATAAGTATCAGTTTCTGTACTTTATTG L. major splice-leader sequence
OL2147 CTCCTTCCGGACAACAGTGCCGGTGC 3' of LmjF28.1480
OL2164 CGGCGGTGCTTTTGCA 3' of LmjF28.1470
OL2165 CTACAATCATGACGAT 3' of LmjF19.0120
OL2166 GATGGCAAGCATGATC 3' of LmjF29.0070
OL2167 GAATAGCATTGCAAAC 3' of LmjF32.0070
OL2168 GCTCTGATTCTCGCGA 3' of LmjF33.1340
OL2169 CGAGGGCTATCATCAA 3' of LmjF35.2720
  1. Primers used to amplify syntaxin-specific products from L. major promastigotes cDNA.