Skip to main content

Table 3 Primers used to amplify target genes in pilot C. elegans TILLING project

From: TILLING is an effective reverse genetics technique for Caenorhabditis elegans

Gene Oligo Name Oligo Sequence
F57C9.5 ce0001Lb GTGCTGAGAATCCTGAACTTGACG
  ce0001R TCTACTTGGCATGTTCGGCGACTG
Y73B6BL.2 ce0002L GGGTTCGCGAATTTCACTTGCATT
  ce0002R CGGCTCCTCTGCGAGTAGTTGGTC
T05A6.2 ce0003L GCGGCGCACTCACATTTTTCTCTT
  ce0003R CTGTGCGGACTTTGGCACATTTGA
C05C10.5 ce0004L GAACTATTTGTGCGCGCGCGTTT
  ce0004R TCAATGAGTGGGGTGGATTCAAGAAGA
C43E11.2 ce0006-3L CTCCGAAATGAGAACTGTCCGACCAAT
  ce0006-3R AAAGCTGAAGAAGTCGAATCGGTGCAT
Y69A2AR.30 ce0007L CGCGATTTCCCTCAAAGGATCTGC
  ce0007R AGAGCACCATCACACCACCTGACG
F25H2.13 ce0008L TCAAAAAGAGACGAAGCCGCTGGA
  ce0008R GCAGCAGCAACATCTTGAGCGTGT
M03C11.2 ce0009-2L CAGCTCAGCTTCTCGTGGAGACCCTAT
  ce0009-2R AGGAATCTTTAGAGCAACCGGGCAAAA
C47D12.8 ce0010L CCGGAATCGCATTGATTCCAAAAG
  ce0010R TGCAGCGAAATCACTTACAATCGTTTCC
C05D11.11 ce0011L CGCCACAAGTACACCAACAACGAGAA
  ce0011R GCGAGATCAGCGACGTCTTTCTTGA