Skip to main content

Advertisement

Table 2 Primer sets used in Q-PCR analysis.

From: Microarray expression analysis of meiosis and microsporogenesis in hexaploid bread wheat

Candidate Affymetrix probe set Acquisition temperature Sense Antisense Product size (bp)
    Sequence Sequence  
ASY1 Ta.9186.1.S1_at 83 AGGACTCCCACAAGCAATCG ACCTGCTGGAGGATCGGCTC 159
DMC1 Ta.30833.1.S1_at 80 GCTGAGGAAAGGCAAAGGCG CGGTGCAGTAGCCTTTGTCGATTT 195
MSH4 Ta.25861.1.A1_at 83 CTGAAGGATGGTGTCCGACG AGGTCCTGCAATGCTTCACG 252
MSH6 Ta.24096.1.S1_at 80 CATAATATTGGCACAGATTGGAG CTGACGAAAGCACGGAAGC 161
PHS1 TaAffx.47591.1.S1_at 80 TGATGCTGCTGGTGGAAATTCG CGGACACTAGGCATGATAGGCG 270
RAD51B Ta.7197.1.A1_at 81 CTGCCTGGCTGAAGCTGAAG GATAGAACAAGCAAACTATGGGAG 267
RAD51C Ta.10540.1.S1_at 79 TATTGATACAGAGGGCAGTTTC AGCTGCATATTCGGAAGTAG 173
RAD54 Ta.7706.1.S1_at 82 GCTGTCGCAAACCCTTTCG GTCGTAGGCACCAATCATCCATC 344
RPA Ta.6986.1.S1_at 83 GAATGTCTTCCGTGAACCG CATCTAAGGACGGGTGCTAG 274
WM5 Ta.25342.1.S1_at 81 CATCGAGTGGGCTTTAGCTATAG CAACACGTAGTACGATAGATCCAAG 178
WMC3* Ta.28776.1.A1_at 79 CGACCGACGGAATTGATATG CTGTGAGAAGTTTCAGCATTATC 171
WMC4 Ta.30383.1.A1_at 80 GATTCCCAAATGTTCGAC CAAATTGTCCTCCTTACG 266
WMC5 Ta.3224.2.S1_at 81 CTTGCTGCTCCCAATGATAATTC CAGTTAGCTGCCAGGTCATCTTTC 245
WMC6 Ta.3385.1.A1_at 80 CGGACAGTCCAGATGTGC CTATGCTTGCTGCCTGATG 271
WMC10* TaAffx.38162.1.S1_at 79 AGGAGTTGACATGACAAGATTAGGGAGG GCCACTTCACATGCACCCATCTAATC 166
Controls      
Cyclophilin   82 CAAGCCGCTGCACTACAAGG AGGGGACGGTGCAGATGAA 227
EFA1   82 CAGATTGGCAACGGCTACG CGGACAGCAAAACGACCAAG 227
GAPdH   78 TTCAACATCATTCCAAGCAGCA CGTAACCCAAAATGCCCTTG 220
Actin   77 GACAATGGAACCGGAATGGTC GTGTGATGCCAGATTTTCTCCAT 236
Flat gene 1 Ta.9657.1.S1_at 83 CCCTCAGACCGCTGGCAA GAGGCGGACAGACATGGAAGAA 300
Flat gene 2 Ta.28350.1.S1_a_at 80 ACGCAGCTACCTGTATCATTCGGATC GAAGCGACGATGTCCACATGACC 160
  1. Primer sets used and the product sizes obtained in addition to the acquisition temperatures used. Control genes in italics were those selected by geNorm for normalisation.
  2. * indicates those transcripts that have an unclear orientation (not known whether sense or antisense).