Skip to main content

Table 1 Summary of screening results of the giant panda BAC library by PCR with primers for microsatellites

From: Construction of a 7-fold BAC library and cytogenetic mapping of 10 genes in the giant panda (Ailuropoda melanoleuca)

Microsatellite Sequence Name Primer (5'-3') Ta (°C) Product length (bp) Positive superpool number
A204 F- CCTGCCCTATGGATTTCAGA
R-GGTCCATATCATGGTCTAAATGA
63 321 10
A066 F- GATTATCCGTTGGCTTTGGA
R- CGTGGTTGTCTCCACACTTG
60 337 3
B043 F- GACCCTGTGGCTCTGTGACT
R- GCGAGGGAAGGAAGAGAAAC
60 310 6
GPMC-1 F- AGAGAGAGAGCGAGCACGAG
R- AGCCACGAAACAGAGAGGAA
63 207 1
GPMC-21 F- GAATGGTATGCCTGGGTGAC
R- AACACAAGCGGGGGAACT
63 150 6
GPMC-40 F- TCCCTCAGCACCTTAACACC
R- TACTGGCCCAGGACACTAGC
58 214 4
GPMC-52 F- CCGTCTCCAAGGTAACCTGA
R- AGAGATTGCTAGGCGGACAA
60 190 3
GPMC-104 F- TCTCCATCAGGTTACCACTGC
R- CTGCGTGCCTCAGTCAGTTA
60 261 4