Skip to main content

Table 2 Summary of screening results of the giant panda BAC library by PCR with primers for functional genes

From: Construction of a 7-fold BAC library and cytogenetic mapping of 10 genes in the giant panda (Ailuropoda melanoleuca)

Gene Genebank accession No. Primers (5'-3') Ta (°C) PCR product size (bp) Positive clone number
ACTIVIN AF350256 F- GGACATTGGCTGGAATGACT
R- GACATGGGTCTCAGCTTGGT
54 207 4
AGXT AJ539311 F- CTGTTTTTCATTGACTGGACTCTG
R- TCTCATCCATTATCTGGGGG
58 539 4
GHR AF367203 F- CCTCTGGGGGAAAAAAAGTT
R- TCATCATCCTTTGCTCCAAG
56 412 8
FSH AF448454 F- TGTTGCTGGAGAGCAATCTG
R- TACGCCAGCTCTTTGAAGGT
54 197 7
FSHR AF415208 F- GCCAAAGGATTTGACACGAT
R- TGGTGACCAGGATCATCAGA
56 202 6
GpH AF448453 F- GCCCAGAATGCAAGCTAAAG
R- ACTGTGGCCTTGGTAAATGC
54 190 5
SOX14 AF016377 F- AACCCCAAGATGCACAACTC
R- ACGTAGCCTCTTGGCCTCAC
54 108 6
IRBP AY303836 F- CCAGGAAGTGGTGAGCAAGC
R- CGGTGAGGAAGAAGTCGGAC
66 419 4
TTR AF039738 F- TCTGCAGAGCTCACTGAACC
R- TTCGATTAGCTGAGGGGAAA
54 205 4
BDNF U56638 F- TCTGGAGAGCGTGAATGGG
R- CGATACAGGGACTTTTTCAAGG
62 394 3
GDNF AF516767 F- TGAAAAGGTCACCCGAGAAG
R- AGCCGCTGCAGTACCTAAAA
54 219 5
NT-4 AY189135 F- AGCGAGACAGCACCAGCAA
R- TCAGACACCCAGTGCCTCC
64 263 5
LH AF448455 F- GCTGTGGCTGCTGCTGAAC
R- CCACAGGGAAGGAGACCATG
58 313 2
ZFX1 AF016379 F- TCGGTTCACACGAAGGACTAC
R- TGATACACCTTCCTGCCACTG
59 284 4
ZFX2 AF016380 F- GGTGCAGCAACATGCTCTTA
R- CCACGTGTTTCTTGAGTTCG
54 188 4