Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 6 List and characteristics of primers and probes used for validation of identified markers.

From: Exploring glycopeptide-resistance in Staphylococcus aureus: a combined proteomics and transcriptomics approach for the identification of resistance-related markers

Gene numberA Sequence (5'→3') Length 5'-Dye Concentration (nM)
SA0591     
F_SA0591-195F TGGCCGTGCAAAAGATTTAGT 21   200
R_SA0591-275R TGTGTAATTGCGAATCCTTGTTG 23   200
P_SA0591-219T TGTAACAAGTCCACGAGAGCGACAACAGA 29 FAM 100
SA2113     
F_SA2113-40F GCCGGTTTAAATGACCGTACTACT 24   200
R_SA2113-117R TTGCAACGCATCACAAAATTG 21   200
P_SA2113-75T CACTTTTGCATAACTTACTTB 20 VIC 100
SA1195     
F_SA1195-799F CCTGATTCAGGGATTTTCCAAA 22   200
R_SA1195-877R TTGGCACAGTCAATGACTTAACATC 25   200
P_SA1195-822T TCACCTCGGATGCCAAAACTCAAACCT 27 FAM 100
SA1691     
F_SA1691-319F CATCATGGATTCGATTTGAAAGG 23   200
R_SA1691-389R CCTTGCACATCTCTGTCGCTAA 22   200
P_SA1691-344T CAACTAGAGCTTTATTTTCAB 20 FAM 100
SA0536.1     
F_SA0536.1-31F GGCGCACCAGTTTATGAAATTAT 23   200
R_SA0536.1-111R TTCAGTATCACTAAATGAATCGTCACAT 28   200
P_SA0536.1-60T AACGTTTCAGCATGTTTB 17 VIC 100
SA0532     
F_SA0532-15F GATTGCGATAACTTCTTTTCTCTAT 25   200
R_SA0532-115R AATCAAACTTAAGCCCTAGATAAA 24   200
P_SA0532-51T CAGTATCAAATTTATCTAGGGCTTAB 25 VIC 100
rRNA16S     
F_rRNA16s-551F GGCAAGCGTTATCCGGAATT 20   200
R_rRNA16S-651R GTTTCCAATGACCCTCCACG 20   200
P_rRNA16s-573T CCTACGCGCGCTTTACGCCCA 21 FAM 100
  1. ABased on the annotation of N315 genome.
  2. B Minor groove binder (MGB) probes with non-fluorescent quencher bound to the 3'-end (Applied Biosystems).