Skip to main content

Table 2 PCR markers analyzed and their replication timing.

From: Genome-wide sequence and functional analysis of early replicating DNA in normal human fibroblasts

Primer set name Sequence Product range Replication time in hrs1(fibroblasts) Woodfine replication timing ratio2
chr6.1385A F ctcagctttccctgttaatg
R ggaagatgctaaatgactgc
30904535–30904712 1.0 1.73
chr6.1385B F ggaattaaggcgtgtatctg
R aacttcccatagggattagc
31023340–31023694 1.5 1.63
chr6.1386A F agtaaatccgggtctctagg
R ccagatagaggcactgagag
32021221–32021449 1.0 1.74
chr6.1386B F aaatgtccttcaccatcaag
R attatcagagcagcaaaagg
32151938–32152179 0.9 1.74
chr6.1395A F atgactcatgtagggcagac
R aaggaggaacaagaggaaac
40489161–40489555 5.6 1.36
chr6.1395B F gtccaagctaagtccatgag
R gatgacaaacatgaatgcag
40560441–40560763 5.5 1.25
chr6.1395C F taggtcagttgacccatctc
R cgtgttcagtgtgtatttgc
40601430–40601688 5.4 1.58
chr6.1401A F caggcccatacttcttgtag
R gtgagagcttctccttgatg
43125237–43125402 1.6 1.73
chr6.1401B F tggttcttctctccagtttg
R taggtgaggacacaagatcc
43237884–43238178 2.1 1.73
chr6.1417A F cagtagtgtgtgcacctgtc
R tccctgtaacttcaaccatc
89898270–89898634 4.6 1.51
chr6.1417B F taaccccactctgtgttagg
R cctatggagtcagagattgc
89963481–89963615 4.8 1.51
chr22.1096A F agggtcacatctacagttgg
R ccatttgctgtcctttctac
23123485–23123611 1.1 1.85
chr22.1096B F aatcctcctgagaattaggc
R caggagtaatgcccacttag
23239758–23239902 0.5 1.72
chr22.1102A F tcaggaggagtttcacattc
R cacagaagactcagggagag
26718830–26718968 1.0, 5.0 1.58
chr22.1102B F gctaggacctgaactcacac
R tttaaagggctgctctattg
26841004–26841279 5.6 1.55
chr22.1110A F gccctgagatactgactctg
R aaatgcagaatgaagtggag
31334872–31335235 1.0 1.55
chr22.1110B F gacattgctcttgcctctac
R cttctcaagggtgtaaatgg
31441419–31441684 1.0 1.54
chr22.1112A F caggcatctgaaattaaacc
R agattagaggctggttttcc
32486488–32486736 6.0 1.68
chr22.1112B F actgagattcaaaccagagc
R agggaaacttggtaatagcc
32533028–32533232 6.1 1.64
chr22.1118A3 F ttcagggtctggttggtagg
R agcaggagactggcacagat
38071800–38072021 0.8 1.99
chr22.1118B F gtggggtgcactgttactat
R atcagggacacgtaaacaac
38181333–38181482 0.8 1.95
  1. 1- Data derived from the average replication time from two synchronizations.
  2. 2- Data derived from lymphoblastoid cells (Woodfine et al. [18, 19]).
  3. 3- Primer is located 25 kb upstream of island in an adjacent clone.