Skip to main content

Table 3 Ste11-Box related DNA motifs identified in known and newly discovered M-specific genes

From: Genomewide identification of pheromone-targeted transcription in fission yeast

Gene Strand Start End M/Ste11-Box Motif1 1 Source
cwp1 D -175 -134 CATCACACCTGAACAAT AGTACGCACTAAACAAAGA GA C this study
mam1 R -161 -122 GTATGGTGGACAACAATG GAGAGTACCTAACAAAG GCCC [14]
mam23 D -158 -119 GACA TAGAAGTGTTTTCTGGAAATTCTAAACAAAGA GGA [14]
mam3 R -340 -301 TATTTGTCAAT TGCAAT ACTAGTACTAAAACAAAG TCTT this study
mam44 R -271 -232 AATTATAGTTGACACAAT AGGGAAGTAAAACAAAGAAA A this study
mat-Mc2 R -83 -44 AACTACTTACAGAACAAAGAAA CCCAAAAACAAAG GAA C this study
mat-Mm2 D -90 -51 AACTACTTACAGAACAAAGAAA CCCAAAAACAAAG GAA C this study
mfm1 D -191 -152 AACAAT TGACTAGACAATG GGTCCGACCAACAAAGAA GT [14]
mfm2 D -172 -133 AAACAATG GGTCAAACAAT AGGCAAATGAACAAAGA GA T [14]
mfm3 D -192 -153 AACAAT TAACTAGACAAT A000GGCCCAACCAACAAAGAA GT [14]
SPAC11H11.03c3 R -319 -280 GACA TAG AAGTGTTTTCTGGAAATTCTAAACAAAGA GGA [14]
sxa2 R -326 -287 TTTACAAT CAACAACAAT AGAGATGGGCAACAAAGA CA C [14]
  1. M-box sequences are underlined and Ste11 binding sites are given in bold.
  2. 1 Motifs were identified in the region 2000 bp upstream of the ATG or in the entire inter-genic region where this is less than 2000 bp
  3. 2 Divergently transcribed gene pair
  4. 3 Divergently transcribed gene pair
  5. 4 Not strictly M-specific. Expression level 2–3 fold higher than that of P cells.