Skip to main content

Advertisement

Table 3 Primers used for RT-PCR analysis

From: Computational and experimental analysis identifies Arabidopsis genes specifically expressed during early seed development

Gene (Atg) Forward primer Reverse primer
At5g09640 GACACACCAAACATCAGAACCG CTACTCATCATCCAAGGTCTCC
At5g22470 TATGCTCTCTTCCGGTTCCTGG ATGGAACCAACCGTCCACAAGG
At5g45690 ACGATTGCGACTCCTCTAAACC GAACGGAGCCAATTTCTGCATC
At1g67100 GCTCATGAACCTCCTCAACACC CCCGATCCAAGTCTTTGGTTCC
At3g60730 TCAAGCTGTGGCGTTGAGAGTG GGTAAACGGAGAAGCCTCTTCC
At3g12203 GGCACTGATCTCTGATGAACAC TTCTGAACCATCCATGGTCTCC
At1g71691 GCTTGTTCTTCATCGGAATGGG TACGACAAGGCGTTTCAAAGGG
At2g43260 TTCCGGCTTGAACCATAACTGC TGAACCACCTTTTCTGCCTTCG
At1g68380 TGTTTTATGGCCGCCGTATTCC TCCAAGTAAGCGTCCTATTCGC
At4g14780 TCAAACTCGCTCTTGATCTCGC TTTCACCACCTCCTTCATCTCC