Skip to main content

Advertisement

Table 5 Primers used for Northern blot probe amplification

From: Gene expression profiling of Naïve sheep genetically resistant and susceptible to gastrointestinal nematodes

Primer Name Primer Sequence 5'-3'
GAPDHF TGAAGGTCCGTGTGAACGGATTTGGC
GAPDHR CATGTAGGCCATGAGGTCCACCAC
GIMAP8F TGCATACCTTTCCCTCTTCG
GIMAP8R GCCTAGCCGTAAATAGGAACC
SPINK1F CGGTGCAGTTTTCAACTGAG
SPINK1R CCAAGCACGCATTGTAGTGT
TFF3F TACGGTCCGGATTCCGGG
TFF3R CCTCATGCTGAGCACGGG