Skip to main content

Advertisement

Table 4 Gene names and primer sequences for QRTPCR

From: In vivo – in vitro toxicogenomic comparison of TCDD-elicited gene expression in Hepa1c1c7 mouse hepatoma cells and C57BL/6 hepatic tissue

RefSeq Gene name Gene Symbol Entrez Gene ID Forward Primer Reverse Primer Product Size (bp)
NM_007393 actin, beta, cytoplasmic Actb 11461 GCTACAGCTTCACCACCACA TCTCCAGGGAGGAAGAGGAT 123
NM_009992 cytochrome P450, family 1, subfamily a, polypeptide 1 Cyp1a1 13076 AAGTGCAGATGCGGTCTTCT AAAGTAGGAGGCAGGCACAA 140
NM_010634 fatty acid binding protein 5, epidermal Fabp5 16592 TGTCATGAACAATGCCACCT CTGGCAGCTAACTCCTGTCC 87
NM_008084 glyceraldehyde-3- phosphate dehydrogenase Gapd 2597 GTGGACCTCATGGCCTACAT TGTGAGGGAGATGCTCAGTG 125
NM_013556 hypoxanthine phosphoribosyl transferase Hprt 24465 AAGCCTAAGATGAGCGCAAG TTACTAGGCAGATGGCCACA 104
NM_010849 myelocytomatosis oncogene Myc 17869 CTGTGGAGAAGAGGCAAACC TTGTGCTGGTGAGTGGAGAC 127
NM_011723 xanthine dehydrogenase Xdh 22436 GTCGAGGAGATCGAGAATGC GGTTGTTTCCACTTCCTCCA 124