Skip to main content

Table 2 SBE primers

From: TAMGeS: a Three-Array Method for Genotyping of SNPs by a dual-colour approach

SNP SBE PRIMER SEQUENCE
control *5'- CATGAGCTAGAAGTCAGGAC ACCATGGTGCACCTGACTCCTG -3'
rs6330 5'- CCACGCATCCAAGATTAGGA GAATGCTGAAGTTTAGTCCAGTGG -3'
rs3738701 5'- CGAGTGACTAGATACGCTAT GGCTAGGGGAGCTGCATTT -3'
rs11466112 5'- CATAGATGGAAATCGGCGCA TGGCAAGCAGGCTGCCTGG -3'
rs11466110 5'- AGAGACGACCTAAGCCAGTC ACGGGGTGAACGGAGTCGC -3'
rs11466111 5'- CGAGTGACTAGATACGCTAT GGGGCAGACCCGCAACATTACT -3'
rs6336 5'- TAACCGCTCGTCATGTGTCT GCTTGGCATCGGGTCCAT -3'
rs6339 5'- ACGGATTCAGCAGTCCTCAT GGAGCCACATCCTCCCCA -3'
rs1799770 5'- AGATGTAGAACACCCGTCAC CTATCCCCTCTCCTTTTCTTGTTC -3'
rs3753213 5'- AGATGCGTGAGCACTACTTG GAGCCTCTAGGAGGTCGTCCTT -3'
rs1800878 5'- CAGTCGGTAGAACTATGTA CCCTCCCTGACCTTCTGGTCT -3'
rs6265 5'- TGCCAGCTAAGACACAGTA CCCTCATCCAACAGCTCTTCTATCA -3'
X60202 5'- GCAAACGGGTTGTAATTCTG GGGTCCACACAAACCTCACG -3'
rs1048218 5'- AACGATCCGGTACATTTAGG TCTTCATTGGGCCGAACTTT -3'
rs1048220 5'- ATCAGGTCTGGAAGATTACG TGCTGCAAACATGTCCATGA -3'
rs1048221 5'- ATGAAGTGCTAGGAATCCGC CAAACATGTCCATGAGGGTCC -3'
rs3750934 5'- TAATGGACATGACGCGACAG AATTACAATCAGATGGGCCACA -3'
rs8192466 5'- AAGTACGTCGAAGCAGCAGC AGTTCCACCAGGTGAGAAGAGTGATGA -3'
rs1047856 5'- AGCTCGATACTGACTGAGAT GCCGTGGTACTCCGTGTGAT -3'
rs2275857 5'- AGAGACGACCTAAGCCAGTC TGGTAATGCTGTTTCTGCTTAAGTTG -3'
rs2289656 5'- ATCTGGCGACGCTATGACGT TCCTGGAGCCCACCTCCC -3'
rs2289658 5'- CATAGATGGAAATCGGCGCA CATCCTTCAGGGTCTGGGG -3'
rs741072 5'- CCTCTGAGTAAATACGGAGA GCATTCCCACACTGGCCC -3'
rs2072446 5'- CTCCGGCATTAGAACATAAC CTGGGGGCTGTGCTGTCC -3'
rs2072445 5'- GTCCGCATTGCATGATGAGT AGGAAGAACACGGCAGTGG -3'
rs734194 5'- ATCATGTCACCAGAGTGCCG CTCCACGTGTAAGCCCTTGA -3'
  1. The sequence of primers used in the extension reactions is reported (in bold the Tag sequence). Control is the primer employed as positive hybridization control and it is labelled at the 5'-end (*) with either Cy3 or Cy5.
\