Skip to main content

Table 1 Primer sets designed by the PLUG system

From: PCR-based landmark unique gene (PLUG) markers effectively assign homoeologous wheat genes to A, B and D genomes

    Primer sequence (5' → 3') Estimated product size
Marker no. TIGR Rice locus ID TaEST clone Forward Reverse Os genomic (bp) Ta EST (bp)
1 LOC_Os01g07960 AY093953 agtacgggaggacgcatgt tctgcaggttcggtagacaat 1128 297
2 LOC_Os01g62430 BT009397 cttcggcagcgatttccta gtgaacgtgaggcctactctg 868 353
3 LOC_Os02g01440 CD453605 ccaccacagaagcagatgaat gctagatggcacaccaagtg 844 208
4 LOC_Os02g49780 CK207954 aacaagatggcgaggaagaac agaactcagatgcaggctcaa 869 216
5 LOC_Os03g03510 CK162308 gtcaagatcgccaaggacac gcctccctcaacaaactcaag 1049 213
6 LOC_Os03g48000 CK158455 aatgcatgttgaacctcgtgt tcaaggagatcgatgagcatt 963 156
7 LOC_Os04g08350 CA486283 acctcacctcatcactggaaa attgcttcagcctcctttctc 1030 296
8 LOC_Os04g41910 CD913720 gagaggaatgcgtgaagtttg agaccatctttccggtctttg 1031 106
9 LOC_Os05g01240 CK162649 tttccgcttcctatgatgcta ttcccatctcttgccattaaa 765 340
10 LOC_Os05g28200 CK168220 gggatagaactctgggacttca agtgccagggcataatacagc 937 147
11 LOC_Os06g13680 CK214580 ctttagcctccttcgcaacat tcctcatggttctcaagcact 1069 89
12 LOC_Os06g46450 CK162440 tttcacaggaacctctgcatc tcaacatttgcaggattgtca 765 150
13 LOC_Os07g16960 CD918004 acgtgtgcgacttgaagagat acagcttgctgcttccagaat 836 171
14 LOC_Os07g30840 DR737909 cgtgctaactttggctgagtc gcactcgttgatgaggaaatc 842 108
15 LOC_Os08g05890 CK206352 Gccagtttcctcgagatcc cacagtactgctttgggttgg 990 144
16 LOC_Os08g44000 CK161204 gcaatatgcggtgcctatact cccagccagtctctcacataat 971 207
17 LOC_Os09g04800 CK162348 cggctacaataacggtgactc ctctgctgatctgaaggatgg 996 322
18 LOC_Os09g36450 CK162719 Ttcttggtcactctgagcgta ttgctagctcagcacagtttg 1007 389
19 LOC_Os10g17280 DN949140 agccattcacagctcttcttg aatatgcttcctggagtcacg 897 226
20 LOC_Os10g32880 CK210932 tcatcgagcgctacattgag ttgtcttgctgtgtgaagctg 1055 217
21 LOC_Os11g06340 CK212529 acccgttgatcccaagaagta cggtatcatcagcctcaactc 923 106
22 LOC_Os11g38020 CA680245 agcaacactggaggagatatcag ccattccaaccttatgtatgtca 880 358
23 LOC_Os12g13390 CK207363 ctcctcggaaggtctcaagat tacaacgcttggttgggtatc 1057 237
24 LOC_Os12g35270 BJ227772 gctacaacccggcactcat tggtgcttcttcgacttcttg 998 88
  1. One TaEST-LUG was randomly selected from each arm of the 12 rice chromosomes, and from these loci, 24 PLUG primer sets were produced. The table shows the TIGR rice locus ID, the accession numbers of wheat ESTs exhibiting homology (scores > 100), the sequences of forward and reverse primers, the size of the region flanked by the primers along the rice genomic sequence, and the size of the region flanked by the primer along the wheat EST sequence.