PCR-based landmark unique gene (PLUG) markers effectively assign homoeologous wheat genes to A, B and D genomes

Ishikawa, Goro; Yonemaru, Junichi; Saito, Mika; Nakamura, Toshiki

doi:10.1186/1471-2164-8-135

BMC Genomics

Table 1 Primer sets designed by the PLUG system

From: PCR-based landmark unique gene (PLUG) markers effectively assign homoeologous wheat genes to A, B and D genomes

			Primer sequence (5' → 3')		Estimated product size
Marker no.	TIGR Rice locus ID	TaEST clone	Forward	Reverse	Os genomic (bp)	Ta EST (bp)
1	LOC_Os01g07960	AY093953	agtacgggaggacgcatgt	tctgcaggttcggtagacaat	1128	297
2	LOC_Os01g62430	BT009397	cttcggcagcgatttccta	gtgaacgtgaggcctactctg	868	353
3	LOC_Os02g01440	CD453605	ccaccacagaagcagatgaat	gctagatggcacaccaagtg	844	208
4	LOC_Os02g49780	CK207954	aacaagatggcgaggaagaac	agaactcagatgcaggctcaa	869	216
5	LOC_Os03g03510	CK162308	gtcaagatcgccaaggacac	gcctccctcaacaaactcaag	1049	213
6	LOC_Os03g48000	CK158455	aatgcatgttgaacctcgtgt	tcaaggagatcgatgagcatt	963	156
7	LOC_Os04g08350	CA486283	acctcacctcatcactggaaa	attgcttcagcctcctttctc	1030	296
8	LOC_Os04g41910	CD913720	gagaggaatgcgtgaagtttg	agaccatctttccggtctttg	1031	106
9	LOC_Os05g01240	CK162649	tttccgcttcctatgatgcta	ttcccatctcttgccattaaa	765	340
10	LOC_Os05g28200	CK168220	gggatagaactctgggacttca	agtgccagggcataatacagc	937	147
11	LOC_Os06g13680	CK214580	ctttagcctccttcgcaacat	tcctcatggttctcaagcact	1069	89
12	LOC_Os06g46450	CK162440	tttcacaggaacctctgcatc	tcaacatttgcaggattgtca	765	150
13	LOC_Os07g16960	CD918004	acgtgtgcgacttgaagagat	acagcttgctgcttccagaat	836	171
14	LOC_Os07g30840	DR737909	cgtgctaactttggctgagtc	gcactcgttgatgaggaaatc	842	108
15	LOC_Os08g05890	CK206352	Gccagtttcctcgagatcc	cacagtactgctttgggttgg	990	144
16	LOC_Os08g44000	CK161204	gcaatatgcggtgcctatact	cccagccagtctctcacataat	971	207
17	LOC_Os09g04800	CK162348	cggctacaataacggtgactc	ctctgctgatctgaaggatgg	996	322
18	LOC_Os09g36450	CK162719	Ttcttggtcactctgagcgta	ttgctagctcagcacagtttg	1007	389
19	LOC_Os10g17280	DN949140	agccattcacagctcttcttg	aatatgcttcctggagtcacg	897	226
20	LOC_Os10g32880	CK210932	tcatcgagcgctacattgag	ttgtcttgctgtgtgaagctg	1055	217
21	LOC_Os11g06340	CK212529	acccgttgatcccaagaagta	cggtatcatcagcctcaactc	923	106
22	LOC_Os11g38020	CA680245	agcaacactggaggagatatcag	ccattccaaccttatgtatgtca	880	358
23	LOC_Os12g13390	CK207363	ctcctcggaaggtctcaagat	tacaacgcttggttgggtatc	1057	237
24	LOC_Os12g35270	BJ227772	gctacaacccggcactcat	tggtgcttcttcgacttcttg	998	88

One TaEST-LUG was randomly selected from each arm of the 12 rice chromosomes, and from these loci, 24 PLUG primer sets were produced. The table shows the TIGR rice locus ID, the accession numbers of wheat ESTs exhibiting homology (scores > 100), the sequences of forward and reverse primers, the size of the region flanked by the primers along the rice genomic sequence, and the size of the region flanked by the primer along the wheat EST sequence.

Back to article page

ISSN: 1471-2164

Contact us

Submission enquiries: bmcgenomics@biomedcentral.com
General enquiries: ORSupport@springernature.com