Skip to main content

Advertisement

Table 2 Amplicon characteristics of primers used for the annotation of the contig and the transcription profiling.

From: Characterization of the genomic region containing the Shadow of Prion Protein (SPRN) gene in sheep

Gene symbol or primer's name Forward primer (5'-3') Reverse primer (5'-3') Ta (°C) Length (bp) Accession number amplicons % nucleic acid identity/amino acid identity/amino acid positivity with described sequences
ECHS1 GCAAAGAATGGGAAAGAACAGCA GGCTCAAAAACCCGCCAGA 65 646 EF215853 OariEST (CD288818): 96/93/94 BtauECHS1 (DQ058603): 96/87/94 HsapECHS1 (NM_004092): 86/80/92
PAOX GCATCTGGACACCTTCTTTGA GTCCTCCCACACCACCTG 65 274 EF215855 OariEST (DY499183): 99/100/100 BtauPAOX (DQ058602): 95/98/100 HsapPAOX (NM_152911): 90/88/94
MTG1 CAGCTACCGCTATCACCGAGGA GCGAGGACTTGCCCACGTT 60 154 EF215854 BtauMTG1 (DQ058604): 92/75/85
SPRN GCGAGGGTGCGTGTGAGG CCTGAGGTCCACGCCCAGTA 68 236 - BtauSPRN (DQ058606): 95/92/93 HsapSPRN (NM_001012508): 79/76/80
LOC619207 GGCTGGTCAACGGCAGCA GGCTCTGTCCCCACGCAGT 65 220 EF215856 HsapLOC619207 (NT_017795): 88/73/84
CYP2E1 AAGAAATTGACAGGGTGATTGG AGGGAAGGAGGTCGATGAAT 60 117 EF215857 OariEST (EE790798): 98/100/100 BtauCYP2E1 (DQ058608): 98/97/100 HsapCYP2E1 (NM_000773): 91/86/94
SYCE1 GACAGCGGCAAGGAGCAGTT GCTTCACATCCTCCAGCTTTGC 65 149 EF215858 BtauSYCE1(NM_001038149): 100/100/100 HsapSYCE1 (NT_017795): 90/90/90
OariBAC273H7 UP GGGACCATCCTGCTGTGACG TCCACTGTCTGCGTCGTCCTC 65 328 EI184560 -
OariBAC265G4 RP TGAGAGGTAAGAAGACCACCAAA TCAACCGCAGAACTATGAACC 63 287 EI184566 -
OariBAC161G10 RP CAGCCTTGACGCACTCCTTT TTTAGAACTGGGCCACACAGC 63 200 EI184563 -
ACTB CGCAGACAGGATGCAGAAAGA GCTGATCCACATCTGCTGGAA 60 148 DQ386889 -
UP CGACGTTGTAAAACGACGGCCAG 55 - - -
RP CACAGGAAACAGCTATGACCATGATTACG 55 - - -
  1. For amplicons containing both exon and intron sequences (ECHS1, MTG1 and SYCE1), sequence identity and positivity is shown for the exon parts of the amplicon.