Skip to main content

Advertisement

Table 2 Amplicon characteristics of primers used for the annotation of the contig and the transcription profiling.

From: Characterization of the genomic region containing the Shadow of Prion Protein (SPRN) gene in sheep

Gene symbol or primer's name Forward primer (5'-3')
Reverse primer (5'-3')
Ta (°C)
Length (bp)
Accession number amplicons % nucleic acid identity/amino acid identity/amino acid positivity with described sequences
ECHS1 GCAAAGAATGGGAAAGAACAGCA
GGCTCAAAAACCCGCCAGA
65
646
EF215853 OariEST (CD288818): 96/93/94
BtauECHS1 (DQ058603): 96/87/94
HsapECHS1 (NM_004092): 86/80/92
PAOX GCATCTGGACACCTTCTTTGA
GTCCTCCCACACCACCTG
65
274
EF215855 OariEST (DY499183): 99/100/100
BtauPAOX (DQ058602): 95/98/100
HsapPAOX (NM_152911): 90/88/94
MTG1 CAGCTACCGCTATCACCGAGGA
GCGAGGACTTGCCCACGTT
60
154
EF215854 BtauMTG1 (DQ058604): 92/75/85
SPRN GCGAGGGTGCGTGTGAGG
CCTGAGGTCCACGCCCAGTA
68
236
- BtauSPRN (DQ058606): 95/92/93
HsapSPRN (NM_001012508): 79/76/80
LOC619207 GGCTGGTCAACGGCAGCA
GGCTCTGTCCCCACGCAGT
65
220
EF215856 HsapLOC619207 (NT_017795): 88/73/84
CYP2E1 AAGAAATTGACAGGGTGATTGG
AGGGAAGGAGGTCGATGAAT
60
117
EF215857 OariEST (EE790798): 98/100/100
BtauCYP2E1 (DQ058608): 98/97/100
HsapCYP2E1 (NM_000773): 91/86/94
SYCE1 GACAGCGGCAAGGAGCAGTT
GCTTCACATCCTCCAGCTTTGC
65
149
EF215858 BtauSYCE1(NM_001038149): 100/100/100
HsapSYCE1 (NT_017795): 90/90/90
OariBAC273H7 UP GGGACCATCCTGCTGTGACG
TCCACTGTCTGCGTCGTCCTC
65
328
EI184560 -
OariBAC265G4 RP TGAGAGGTAAGAAGACCACCAAA
TCAACCGCAGAACTATGAACC
63
287
EI184566 -
OariBAC161G10 RP CAGCCTTGACGCACTCCTTT
TTTAGAACTGGGCCACACAGC
63
200
EI184563 -
ACTB CGCAGACAGGATGCAGAAAGA
GCTGATCCACATCTGCTGGAA
60
148
DQ386889 -
UP CGACGTTGTAAAACGACGGCCAG 55
-
- -
RP CACAGGAAACAGCTATGACCATGATTACG 55
-
- -
  1. For amplicons containing both exon and intron sequences (ECHS1, MTG1 and SYCE1), sequence identity and positivity is shown for the exon parts of the amplicon.