Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 3 Amplicon characteristics of the SPRN primers used.

From: Characterization of the genomic region containing the Shadow of Prion Protein (SPRN) gene in sheep

Number SPRN primers Forward primer (5'-3')
Reverse primer (5'-3')
Ta (°C)
Length (bp)
Position in sequence DQ870545
1 ACTCCGGCTCTGGGCTCTGT
GGCTCTGTCTTGCTTTCCAAGGT
63
645
1–645
2 TTCAGGGACCACAGGATCGAA
CCACGGGCTTCAGCACCTC
60
487
549–1035
3 GTGCGAAGTTGGGGTGAGGA
AGCGGGTGAGGGTCTGGAAG
60
330
973–1302
4 GAGGACGGATGCGGTGGAG
CCAAAGGAAGCGGGTGAGG
64
601
988–1588
5 CAGGGGTCGCCTCTGGTC
CTGCTGGAGGAGTGGGGAGT
64
507
1375–1881
6 ACCCTCACCCGCTTCCTTTG
TAGCAGCAGAGCCCAGCACA
66
486
1619–2104
7 CCGCCCCTGAGCCCTGAC
CCGCATCCTCCAGGCCAAG
66
334
1967–2300
8 CCGTGTGCTGGGCTCTGCTG
GGCGCTCCGTCCTCTGCATC
68
256
2082–2337
9 GCGAGGGTGCGTGTGAGG
CCTGAGGTCCACGCCCAGTA
68
236
2189–2424
10 AGCTTGGCCCGGAGGATG
CCTGGGTGAGGGTGTTCTGG
66
678
2384–3061
11 AGCCCACCCTGGACACTTGA
AGCTGGAGGGAAAAGCACCTG
66
446
2852–3297
12 GGTGCGTCTGTGGATCTGTGAG
CTCCCGCTGGTCTTGTGGAG
66
655
3071–3725
13 TCTGGTTGCGGTCAGGGTCT
TGAAGTCGGGTTGTTGAGTGGAA
65
423
3574–3996
14 GCCAGATGCCCTCCATCCTC
CTGCGAGCACCTTCCAGCTAA
65
571
3760–4330
15 GGAGGGTCGCAACACCACT
GGCAGCAGAGTTTATTTCACCAC
65
279
4226–4504
16 CCCGCTTCCAGAATGTGCAG
TCCCAGTTCCGTCATGGTCGT
66
300
4263–4544
17 GTGACCTTCCTGCCCTTCAGGTGT
GTGTCTGCCCTTCAGCTTCGTGA
68
250
4354–4544
18 TCCCAGTTCCGTCATGGTCGTGTCTGCCCTTCAGCTTCGTGA(T)18 - -