Skip to main content

Advertisement

Table 3 Amplicon characteristics of the SPRN primers used.

From: Characterization of the genomic region containing the Shadow of Prion Protein (SPRN) gene in sheep

Number SPRN primers Forward primer (5'-3') Reverse primer (5'-3') Ta (°C) Length (bp) Position in sequence DQ870545
1 ACTCCGGCTCTGGGCTCTGT GGCTCTGTCTTGCTTTCCAAGGT 63 645 1–645
2 TTCAGGGACCACAGGATCGAA CCACGGGCTTCAGCACCTC 60 487 549–1035
3 GTGCGAAGTTGGGGTGAGGA AGCGGGTGAGGGTCTGGAAG 60 330 973–1302
4 GAGGACGGATGCGGTGGAG CCAAAGGAAGCGGGTGAGG 64 601 988–1588
5 CAGGGGTCGCCTCTGGTC CTGCTGGAGGAGTGGGGAGT 64 507 1375–1881
6 ACCCTCACCCGCTTCCTTTG TAGCAGCAGAGCCCAGCACA 66 486 1619–2104
7 CCGCCCCTGAGCCCTGAC CCGCATCCTCCAGGCCAAG 66 334 1967–2300
8 CCGTGTGCTGGGCTCTGCTG GGCGCTCCGTCCTCTGCATC 68 256 2082–2337
9 GCGAGGGTGCGTGTGAGG CCTGAGGTCCACGCCCAGTA 68 236 2189–2424
10 AGCTTGGCCCGGAGGATG CCTGGGTGAGGGTGTTCTGG 66 678 2384–3061
11 AGCCCACCCTGGACACTTGA AGCTGGAGGGAAAAGCACCTG 66 446 2852–3297
12 GGTGCGTCTGTGGATCTGTGAG CTCCCGCTGGTCTTGTGGAG 66 655 3071–3725
13 TCTGGTTGCGGTCAGGGTCT TGAAGTCGGGTTGTTGAGTGGAA 65 423 3574–3996
14 GCCAGATGCCCTCCATCCTC CTGCGAGCACCTTCCAGCTAA 65 571 3760–4330
15 GGAGGGTCGCAACACCACT GGCAGCAGAGTTTATTTCACCAC 65 279 4226–4504
16 CCCGCTTCCAGAATGTGCAG TCCCAGTTCCGTCATGGTCGT 66 300 4263–4544
17 GTGACCTTCCTGCCCTTCAGGTGT GTGTCTGCCCTTCAGCTTCGTGA 68 250 4354–4544
18 TCCCAGTTCCGTCATGGTCGTGTCTGCCCTTCAGCTTCGTGA(T)18 - -