Skip to main content

Table 3 List of primers used in qRT- PCR

From: Global gene expression profiling in human lung cells exposed to cobalt

Gene ID Gene Name GenBank ID Forward primer Reverse primer Amplicon (bp)
AXL AXL receptor tyrosine kinase NM_001699 GACCGGCCAAGTTTTACAGA ATAACCTCCACCCTCATCCA 117
BAG1 BCL2-associated athanogene NM_004323 GCAGCAGTGAACCAGTTGTC CGGTGTTTCCATTTCCTTCA 119
BHC80 BRAF35/HDAC2 complex (80 kDa) NM_016621 CCGAGCCGTTTGTTTAGGTA CACTGGGGTTGGTGAAATCT 117
BNIP3L BCL2/adenovirus E1B 19 kDa interacting protein 3-like NM_020221 ATGTTTGGCTTTGGGGCTA CTTCACAGGTCACACGCATT 109
DLG1 discs, large homolog 1 (Drosophila) NM_004087 CAGCCAGATACTCCCCAGTT TGAGCCACGATGAAGAACAA 89
DNAJA2 DnaJ (Hsp40) homolog, subfamily A, member 2 NM_005880 CCAGGGTGTGTTCGTGTAGTT TGGGTTGATCCAGTTGTTTTC 120
FBXL2 F-box and leucine-rich repeat protein 2 NM_012157 CAGAACTGCCGAAACATTGA CACACAGGAGGTCAGATCCA 123
FIGF c-fos induced growth factor (vascular endothelial growth factor D) NM_004469 GAACACCAGCACCTCGTACA TGGCAAGCACTTACAACCTG 118
GFRA2 GDNF family receptor alpha 2 NM_001495 GAGACACACGGTCACTGGAA TCGAGGACGAGAGACTGGAG 126
GNB2L1 guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 NM_006098 GGTGTCTTGTGTCCGCTTCT CAATGTGGTTGGTCTCAGC 119
HOXA9 homeo box A9 NM_152739 CACCAGACGAACAGTGAGGA ACTCCGTTACAATCAGCATTCA 111
HSPCB Heat shock protein HSP 90-beta NM_007355 GGAGAGGAGGAGGTGGAGAC GAGGGTTGGGGATGATGTC 217
IFNA4 interferon, alpha 4 NM_021268 GAAGAAATACAGCCCTTGTGC TGAACCAGTTTTCAATCCTTCC 114
IFNAR2 interferon (alpha, beta and omega) receptor 2 NM_000874 GTCTCGCTAAGGGCTGGAAT AGGCAGGACGACTGTTTGAG 94
LTBP3 latent transforming growth factor beta binding protein 3 NM_021070 CCAGGGCTACAAGAGGCTTA GGCAGACACAGCGATAGGAG 119
MAPK10 mitogen-activated protein kinase 10 NM_002753 CTTCCCAGATTCCCTCTTCC GTAAGGCGTCGTCCACTGAT 128
MAZ MYC-associated zinc finger protein (purine-binding transcription factor) NM_002383 CGGATCACCTCAACAGTCAC ATGGCACTTTCTCCTCGTGT 135
MYC v-myc myelocytomatosis viral oncogene homolog (avian)(MYC) NM_002467 AAAGGCCCCCAAGGTAGTTA TTTCCGCAACAAGTCCTCTT 103
NDRG4 NDRG family member 4 NM_020465 ATGCTTTCCATCCACTCACC TTCACTGCTCTCTCCCGTTT 115
OAZ1 ornithine decarboxylase antizyme 1 NM_004152 GAGCCGACCATGTCTTCATT CCCGGTCTCACAATCTCAAA 100
PGF placental growth factor, vascular endothelial growth factor-related protein NM_002632 ACCCCTTGGAGGAGAGAGAC GCATTCAGCAGGGAAACAGT 119
SERPINC1 serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1 NM_000488 CAATCGCCTTTTTGGAGACA TGGACACCCATTTGTTGATG 146
SIN3A SIN3 homolog A, transcriptional regulator (yeast) NM_015477 CTCCCAACTGCAAGCACATA TCCCAACGAGATTGTCACTG 115
SLC12A5 solute carrier family 12, (potassium-chloride transporter) member 5 NM_020708 CAAGGGTCCAACTTTTCCTG GCCTCTCGGTTTCTTCCTCT 152
SLC25A6 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 NM_001636 CTGTTTTGCACAGCCGAGTA TTTTGACCTCTGCGTCCTCT 87
SLC2A1 solute carrier family 2 (facilitated glucose transporter), member 1 NM_006516 GTGGAGACTAAGCCCTGTCG CATAGCCACCTCCTGGGATA 128
ST13 suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) NM_003932 AGGCAGACGAACCATCAAGT TCCGTTATCTCCGCATTTTC 115
TFRC transferrin receptor (p90, CD71) NM_003234 CGCTGGTCAGTTCGTGATTA TCAGGCCCATTTCCTTTATG 134
TIMP2 tissue inhibitor of metalloproteinase 2 NM_003255 TTCATTCGTCTCCCGTCTTT ACCAACGTGTGTGGATCAAA 113
TNFRSF9 tumor necrosis factor receptor superfamily, member 9 NM_001561 AGGGCTGTTGGGACTTTCTT GGATGGTGTTCTTGCTTTTGA 83
TUBA3 tubulin, alpha 3 NM_006009 CCTACAACTCCATCCTCACCA GTCAACATTTCAGGGCTCCA 203
UBC ubiquitin C NM_021009 GGAACAGGCGAGGAAAAGTA AACAAGAACTGCGACCCAAA 146
ZNT1 solute carrier family 30 (zinc transporter), member 1 NM_021194 ACCCAGAAAACCCCAGAAGT CACTGAACCCAAGGCATCTC 158