Skip to main content

Table 4 Marker genes used in TRAC analysis.

From: Monitoring of transcriptional regulation in Pichia pastoris under protein production conditions

Probe name Gene Location of the probe in CDS Probe length (nt) Tm (°C) GC% Probe Sequence 5'-3' Pool
ACS1 ERGO:RPPA07570 893–917 25 65.2 48.0 TACTTGGTGGTCAAAAGAGCTCCCA 1
SSE1/2 ERGO:RPPA10049 538–564 27 63.7 44.4 TTTGACGAGCTTCTCAACTGTCCTGTA 1
VPS17 ERGO:RPPA07986 1583–1611 29 64.2 44.8 ACCTGCAGACTGGGTGCTAACTTTTTTCT 1
LC 2F5Fab_light_chain 409–439 31 65.6 41.9 GTACTTTGGCCTCTCTGGGATAGAAGTTATT 1
RPL3 ERGO:RPPA07957 489–521 33 64.9 45.5 TTTTGGTTCAAAGGGGTCTTTCTGATCTGGGTG 1
SEC61 ERGO:RPPA04132 848–882 35 65.4 40.0 CATGATTGGCATGTTGGATGTGTAGAACAATCTGA 1
PDI1 ERGO:RPPA04694 768–804 37 64.3 40.5 GGCTAAAGGGATGTTAGCTTCAGCATATGATTTGAAG 1
TRR1 ERGO:RPPA06201 815–853 39 66.4 46.2 CGAAAACACCTGGAATAGATGTAAGGGAAGAACCTGGGA 1
RIB1 ERGO:RPPA08084 756–796 41 66 39.0 AAGAACGTTTGTCTGCTGGGTGTCTTAGTAAAAGATTTGCT 1
TKL1 ERGO:RPPA06932 1782–1824 43 67.5 39.5 TATTGGAACACCGTCTGGAAGGACTGATAATTGGTAAGATCTA 1
ARG1 ERGO:RPPA07954 813–857 45 70.1 44.4 GTCAAACCTGGAGTTTCATAACAACCTCTGGACTTGATTCCGATG 1
SNZ3/2 ERGO:RPPA10229 557–581 25 63.3 44.0 ATGGCAGCAGCTATCTTTTCAGGAT 2
PMT6 ERGO:RPPA04967 1054–1080 27 62.8 44.4 GTAATCTGTTGTTGGCTGGAACCTTGA 2
GCN4 ERGO:RPPA07905 359–387 29 67.1 48.3 AACGGCTGGAGTGGTAGCAAGAGTAGTTT 2
SSA4 ERGO:RPPA10651 1605–1635 31 65.9 45.2 CATATGATTCCAAGCCATTCTTGGCAGCAAC 2
HC 2F5Fab_heavy_chain 669–701 33 67.9 48.5 GATTTGGGCTCAACTTTCTTGTCCACCTTGGTG 2
KAR2 ERGO:RPPA06939 1325–1359 35 65 40.0 AGTTGGGATAGCAGTGTTTCTGTTGATTAAGGTAG 2
SEC53 ERGO:RPPA08162 349–385 37 63.8 40.5 CGTTTCTGAACTCAATGAATGTTCCTCTTCTGATTGG 2
IMH1 ERGO:RPPA04985 1949–1987 39 62.4 38.5 TGTCTTTTTCCAATTCATCTCGTTTGGAGAGGACTAAAG 2
BFR2 ERGO:RPPA04523 700–740 41 65.8 39.0 AACTCTTGGCTCACAATCTTGCTTTTGTTTAATAGCTTGCC 2
SEC31 ERGO:RPPA06211 1243–1285 43 70 44.2 TTTCGTCGACAAGAGTTTGGTAATCGTTTGTGCTGATGGTGCT 2
HSP90/82 ERGO:RPPA05876 891–915 25 63.9 48.0 CTTAACAGCCAATGGGTCTTCCCAA 3
ARO4 ERGO:RPPA09892 786–812 27 62.8 44.4 TTTCCGTGGGAACAGTCAATCATCAGA 3
ERO1 ERGO:RPPA06115 1531–1559 29 64.4 44.8 TCTCGGTGCCTTTGAGTGCCAATGAAAAT 3
TAL1 ERGO:RPPA08309 550–580 31 63.5 41.9 CCTTGTACCAGTCAAGAATACGTCCAACAAA 3
BMH2 ERGO:RPPA07190 546–578 33 66.1 48.5 AAATGACAGGCGCGGTCAGGAGAGTTTAGAATC 3
ROT2 ERGO:RPPA08267 1634–1668 35 63.3 40.0 ATACGACCTAGTAAGAACAAATGGCCTATGGTTTG 3
GLR1 ERGO:RPPA07699 965–1001 37 67.7 45.9 CTGTTAGATAGTTTTCTACCAGCAGCGATTGCGACAG 3
RAD16 ERGO:RPPA09210 1007–1045 39 63.6 38.5 TATTGTGGGCTTCGTCTAAAATGACCCTATAAAAATGCG 3
GSH2 ERGO:RPPA06484 949–989 41 61.8 39.0 AGAATTTGTTGAACTTTTTTACAACCGCTAAGCTGGGTCAG 3
RAD2 ERGO:RPPA08434 361–403 43 65.8 39.5 CTTGGGTAACCTCATCCGAATCTCTTTGGTCTTTTTTATGTTG 3
CNE1 ERGO:RPPA04260 749–793 45 69.9 42.2 GGATGTACAATTCAGCATCTTCGTTCCAGTTTTCTGGTTTCACAG 3
HOG1 ERGO:RPPA06104 581–605 25 67.8 56.0 TCATCTCGGCGAAAATGCACCCTGC 4
SEC18 ERGO:RPPA05138 1027–1053 27 63.5 40.7 TACCAATATCCAGCTTGTTGGTACCAA 4
CUP5 ERGO:RPPA08088 123–151 29 63.3 41.4 CACTGTATTCTTGATCAGTAAGTCTGGAC 4
SAR1 ERGO:RPPA08441 475–505 31 62.9 38.7 CCTGTCTTAAGTAGATAGAGCAGGTAAATAC 4
ARL3 ERGO:RPPA09566 336–368 33 62.5 42.4 AACGTCCTGTTTATTGGCAAGCATAAGAATCGG 4
DFM1 ERGO:RPPA10235 824–860 37 63.1 40.5 CATTTCTTATCGCAGTAGCTTGGTTTTTCCGTCTTTG 4
HEM12 ERGO:RPPA08255 816–852 37 63.1 40.5 TGGACGGAATAACCAATCCAACGAGACAACATCATAA 4
RAD54 ERGO:RPPA04321 2193–2231 39 63.9 38.5 ACACATGAACTCAATTGCAGTTTAGCTGATTGTCTTTGG 4
RPS23B ERGO:RPPA09269 187–227 41 66.2 41.5 AACTGAACTCTGACACACTTTCTAATAGCGGAGTTAGGTTG 4
MSN2 ERGO:RPPA05326 985–1027 43 70.5 41.9 GCTCATTCGTGTCTATGGACTTTGCCCTCTTTCTTTGTTTTGT 4
SSO2 ERGO:RPPA06663 356–400 45 71.4 40.0 GCTGTTCTCTGTAGTTGCTTTCAATAATACGGTAGTCCTGAATAG 4
GLT1 ERGO:RPPA07339 1740–1764 25 63.4 48.0 CACAATCGATTCCCTGATGGGATCA 5
UBC1 ERGO:RPPA09581 273–299 27 64.4 44.4 AGAATAGGCGTCCAGGCATTCTTCAAT 5
HSP12 ERGO:RPPA05227 211–239 29 64.8 44.8 TGAACTTGCTCAACTAAGGTAGGTTGGGT 5
PFK1 ERGO:RPPA04164 2447–2479 33 63.4 39.4 TTTTACCCGATTTGTTCTTACCATCGTCTTCCT 5
CIT1 ERGO:RPPA10025 758–792 35 67.1 40.0 GATAGACAGGTATAATCTCATCAGCTCAACGAACT 5
HRD1 ERGO:RPPA05158 1188–1222 35 63.8 42.9 TGAAGGAATTATCGGAATTGGACTGCAGTGGGAAT 5
SNC1 ERGO:RPPA04520 275–313 39 63.9 41.0 AGGAACGATGATAACAATCAGCAAAATCACGATTCCCAG 5
KIN2 ERGO:RPPA04639 640–680 41 70.6 43.9 TTTACGGTTGCATCGTAGTCATCAAATTCTGTCCCGTCAAG 5
TSA1 ERGO:RPPA06990 540–582 43 66.5 44.2 GGACTTGGAAAAGAATTCCTTGGAAGCATCAACTTCTGGCTTG 5
CPR5 ERGO:RPPA09912 314–358 45 71.9 42.2 TGAAGTTCTCGTCCTTGAATCTGCTACCGTAGATAGATTTTCCTC 5
  1. The P. pastoris specific probes designed for TRAC, divided into five pools according to their migration in capillary electrophoresis. Location of the probe in the coding sequence (CDS) is indicated. All oligonucleotides are labelled with 6-FAM at 3' and 5' ends.