Skip to main content

Table 6 Primer pairs used to analyze gene expression by quantitative RT-PCR, and size of product

From: Profiling of chicken adipose tissue gene expression by genome array

Gene Forward primera Reverse primera Size
PCC AGGGAAAGGTCGTGGCG CCACTGCCAAGGACACTAGG 137 bp
PBP2 GAGTAAAGTCCGAGAACGAATG AAATCCAGTAGTGGGACAAAGG 185 bp
TNFAIP1 TTCACTCTTAGAAATGCTGGTG CTAAGTTAGTGGCAAAGCTGG 169 bp
FLT1 CTCTTTGGCATGAAAGGTGTC CGTAGGTGTATCTTCGCTTGG 124 bp
G3PD CTCCCATCCCATACCGACAG GGCATATCGACTGCGTGTCC 167 bp
LRP12 GGAGTGTCAACGGCTTGTGG ATCGGCGTGATCCCTGAACA 184 bp
PER GGATCATGTGCGTCCTGTC GGAGCAGCAGATAAACCCAC 210 bp
ST7 GTTCTATGTTGCCTTGACAGG AAGTGGCTCACCGAGACCT 120 bp
ERO1 TTCAAGCCTCGATCTGTCTA TCAAGAAGATAATTGGCACAC 182 bp
ATXN3 AAAGGTGACCTGCCAGAC TTGCTTGGTCCACATCAC 142 bp
PARVA GTGTACTTAGTCCTGCTAATGGG TCTGGTCTGGGCTTTGGTT 161 bp
CWF19 ATCCCAGGGAAGTCTCGC CTTTAGGCTCCTGTGGTTCAG 127 bp
Stxbp4 CCAAGATTTGAGAAAGAGGGTT TCACTTAGAACAGCCGAGGAA 162 bp
ACO GCTGTGCTCTATCAAGGTGGC ACAAGGGCAACTGCGTCATC 110 bp
SOCS7 CATCCCAAGTTTGAAGACCG CATTGCTGAACCTGGAGACG 163 bp
GAPDH AGAACATCATCCCAGCGT AGCCTTCACTACCCTCTTG 184 bp
  1. a,: Sequences of oligonucleotides are indicated from 5' to 3' end