Skip to main content

Table 5 Taq-man qPCR-assay details

From: Differential gene expression in femoral bone from red junglefowl and domestic chicken, differing for bone phenotypic traits

Gene name Ensembl transcript ID1 GenBank ID2 Forward primer Reverse primer Reporter Probe
WDR5 ENSGALT00000004189 [GenBank:CN225644] CTCTTAAGCTTTGGGACTACAGCAA AGTACTTCTCATTTTTGTGTCCTGTGT TCTTCAGGCACTTTCC
PTK1 ENSGALT00000026060 ENSGALT00000026061 ENSGALT00000030798 [GenBank:CN232734] TCCGCCAGAGGAGTACGT GCGACTCATCCACTGTTGCTA CAAGCCAACCTCCTTTACC
TGOLN2 ENSGALT00000023308 [GenBank:CN223571] CGGCGGCCCAAATCTG GCAGCTTTCTTCCACTGAATACCT CCTGGATCAAAAGATCTAG
WIF1 ENSGALT00000016042 [GenBank:BU128191] CGGGATTCGAAGGAGACCAAT TCTTACCCATACATTTTCCTCCATTTCG ATGGCATTTACTGATTTCAC
GAPDH ENSGALT00000014280 ENSGALT00000023323 [GenBank:CN233267] GGAGTCCACTGGTGTCTTCAC GCTGAGATGATAACACGCTTAGCA CCCTTCAGATGAGCCCCAG
EDIL3 ENSGALT00000025199 ENSGALT00000025200 ENSGALT00000025201 [GenBank:CN224434] CCTACAAGCTTGCCTACAGTAATGA ACATTCTTCCGGTGTGTGTCAT CCTGGAAAACCTTGTCCTTC
CDCA8 ENSGALT00000000432 ENSGALT00000008916 [GenBank:CN226240] GTCTTCATTACCGTTCCTGTTGGA CCTCCGGATTGAGATGAAGAAGATT CTGTTAAACGAATGCTCTCCC
LIMS1 ENSGALT00000027130 [GenBank:CN228750] GCAGTTTCCTGAAGGGCTCTT ACCACACTGATGGCAGCAA TTCCTCCCTTCAAACTCAT
NCE2 ENSGALT00000006045 [GenBank:CN227630] GCTGGGCTCCAACTAGAACATT CAAAGGATCGTCAAAATTCAGAAGATCAG CCCCAGACAACATCCTTT
NDUFA7 ENSGALT00000000895 [GenBank:CN225183] CGGCTCCGCAACTTCCT GCTGCGTCCTCTTGGAGATC CTGGAGGTCCCGCCCC
  1. 1 Transcripts targeted by each Taq-man assay. Specified are Ensembl transcript IDs.
  2. 2 GenBank ID of probe for which assay was designed.