Skip to main content

Advertisement

Table 3 List of candidate genes studied and marker information

From: Mapping a candidate gene (MdMYB10) for red flesh and foliage colour in apple

Gene type Gene ID Marker type Forward primer Reverse primer PCR product (bp) LG
  MdMYB10 Indel CGAGTGCTAATAGCAACC CCTCTGTTGGCCGAATACAC 786 9
    AATGGCCTACCACATCATTG   1,182  
  MdMYB9 SSR TCCATAACCTTCTTGGTAACAG AAGGAGAATCGGCTTTCGAT 329 NP
  MdMYB17 SSR TGCTCCTCTCTAGCTATTGCATAAT AAGACTCACAAACTAGCTGTCAAAT 205 14
Transcription factors MdBHLH33 SNP TGGCATTCAGCTAAAACCT AAT TCTCTGGCACCCTCTCTTGG 145 NP
  MdANL2 - - - - -
  MdBHLH3 SSR CAACTCCCCTTATTCTTCTTCTCTC CACCTGACCTTCTCTCTACCTCTAC 170 11
  MdMYB12 SSR CTCGGCAATCGGTAAAGCTA TATGAACAGTGAAACCCTAACCCTA 152 3
  MdTTG1 SNP CACCCGAACCCCAACGG CCA CTCTCCAGCTCCGCCACTG 527 15
  MdBAN SNP GTTGGGTGAGCTAGAGATATTC GATACTGCTGGGAACGTCA GGA 472 10
  MdCHS SNP GAGGAAGTTCGCAAGGCTCA CCCCATTCCTTG ATGGCT A TGA 343 NP
Flavonoid pathway MdDFR SNP CTGTGAATGTGGAGGAG GAC TCAGTTTTCTCTGCCGGAAT 616 UL
  MdF3H SNP GGCGTGAAATTGTGACCTACTA TTT TGACCACAAAAGCTCCTTCC 392 NP
  MdANS SNP TCAGACCTAAAGATGAC CTT TCCTGACCTTGTCCATGAGC 1,449 NP
  1. NP: not polymorphic in the M.9 × 'Robusta 5' population. UL: unlinked. LG: linkage group. The SNP position in the allele-specific primer is underlined. Extra mismatch in the allele-specific primer is shown in italics. No marker could be designed for MdANL2, because neither SNPs nor SSRs were detected.