Skip to main content

Table 1 The primer list of qRT-PCR, RT-PCR, and dsRNAs template

From: Anopheles gambiae heat shock protein cognate 70B impedes o'nyong-nyong virus replication

Gene ID (GenBank Accession No.) Primer sequence (5' to 3') Product size (bp) Amplification efficiencyc (Rd)
aqRpS4 (AJ283756) Forward: GCTGCCGCTGGTGATCTT
Reverse: TCGTCACCTCGCTGTTGGT
65 0.90 (0.99)
qHSC70B (AL930714) Forward: GCGATCCAGGCCGACAT
Reverse: TCTTTGGCTTGCCCTCGAT
64 0.97 (0.99)
EF-1α (XM308429.1) Forward: CGAGAAGGAAGCTCAGGAGA
Reverse: ACGACGACACCTCCTTCTTG
404  
agglutinin (XM311465.2) Forward: CGGGCGAAACTTACTACAGC
Reverse: CGATGGCTACGTTACGGAAT
435  
HSC70B (AL930714) Forward: GTGAACGAGGCCGAGAAGTA
Reverse: TAGTCGACCTCCTCGATGGT
410  
RpS7 (XM_314557.2) Forward: ATCGCTATGGTGTTCGGTTC
Reverse: GCTGCAAACTTCGGCTATTC
627  
E1 (AF079456.1) Forward: AGAGCCCACACAGCTTCAGT
Reverse: ACCGGGTTTGTTGCTATCTG
431  
NS1 (AF079456.1) Forward: CTTCCTGATGTGCAAGACGA
Reverse: ACGACCACAGGCTTGGTATC
440  
bdsEF-1α (XM308429.1) Forward: TAATACGACTCACTATAGGCG AGAAGGAAGCTCAGGAGA
Reverse: TAATACGACTCACTATAGGAC GACGACACCTCCTTCTTG
442  
ds-agglutinin (XM311465.2) Forward: TAATACGACTCACTATAGGCG GGCGAAACTTACTACAGC
Reverse: TAATACGACTCACTATAGGCG ATGGCTACGTTACGGAAT
473  
dsHSC70B (AL930714) Forward: TAATACGACTCACTATAGGTT ACGGTGCGAGCAGAAAAT
Reverse: TAATACGACTCACTATAGGCA CGTTCAGTCCCGAGATGT
652  
dsβ-gal (NC000913.2) Forward: TAATACGACTCACTATAGGGG TCGCCAGCGGCACCGCGCCTTTC
Reverse: TAATACGACTCACTATAGGGC CGGTAGCCAGCGCGGATCATCGG
545  
  1. aq represent the primer pairs for quantitative RT-PCR, bds represents the primer pairs of the templates for dsRNA includes T7 promoter for in vitro transcription. cAmplification efficiencies were calculated from the slope of standard curves as E = 10[-1/slope]-1. 100% PCR efficiency corresponds to an amplification efficiency of 1(Applied Biosystems Application Note); dRegression coefficient of linear standard curve.