Skip to main content

Advertisement

Table 7 Primer sequences.

From: Gene expression of transporters and phase I/II metabolic enzymes in murine small intestine during fasting

Gene symbol Forward primer Reverse primer
Abca1 CCCAGAGCAAAAAGCGACTC CCCAGAGCAAAAAGCGACTC
Abcg8 AGTGGTCAGTCCAACACTCTG GAGACCTCCAGGGTATCTTGAA
Chst4 GTCTTTGATGCCTACATGAACCC GTGGGCAGGGAAGAAGTCA
Cyclophilin CAGACGCCACTGTCGCTTT TGTCTTTGGAACTTTGTCTGCAA
Cyp2j6 TTAGCCACGATCTGGGCAG CTGGGGGATAGTTCTTGGGG
Cyp3a11 TGAAACCACCAGTAGCACACTT CAGGTATTCCATCTCCATCACA
Cyp4a10 ACCACAATGTGCATCAAGGAGGCC AGGAATGAGTGGCTGTGTCGGGGAGAG
Cyp27a1 GCCTTGCACAAGGAAGTGACT CGCAGGGTCTCCTTAATCACA
Dtd AAGAGCAGCATGACCTCTCAC CTGCCTCAAGTCAGTGCCT
Fatp2 ACAACATTCGTGCCAAGTCTCT CTCCTCCACAGCTTCTTGTAGATC
G6pt1 GGCTACGGCTACTATCGCAC AGGAGGGCATGACAAAGGAGA
Gstm3 CCCCAACTTTGACCGAAGC GGTGTCCATAACTTGGTTCTCCA
Mct4 GAGGTGGTTCATACCCCGGAAA ATATGAGCGTTGCCCAGTCTCT
Mgst1 TCGCACTGACGAGAAGGTG TGCATGAGGGCTGTAGAGAGA
Nadc1 TCACAGCCTTCCTCTCCATGT ACTATTGCCTTCCTCCACATCCT
Slc25a28 AGCATTGCGTGATGTACCCG CCTGTTGCTGTGACGTTCA
Slc25a36 GTGAACCGAGTAGTGTCCCCT CCTTGCAGTTTGAATAAGCAGC
Sult1d1 ATGTCTTCAGGAGGGAGTTAGTG CATCAGGCCGGGCTTCAAA
Zip4 ATGCTCCCAAAGTCGGTCAC CAGCGTATTTAACAGGCCGTC
Znt2 AACTGCCAGGCGTGCCAGGG CCGTGGAGTGGTCCAGGCTGTG