Table 2 Unisequences of Microbotryum violaceum blasting against pheromone receptors. For each of the four unisequences significantly blasting against pheromone receptors: best hits, primer designed for PCR amplification, expected size from the EST sequence, rough amplification size obtained, and mating type of the sporidia that gave amplification products.
Number of ESTs | Best hits | Primers | Contig size obtained from ESTs | Rough amplification size | Amplification in sporidia of mating type | |
|---|---|---|---|---|---|---|
Contig588 | 3 | Rcb1 of Coprinopsis cinerea | F1: GGAAGGCCATTACAAGAAAGG | 350 | 500 | A2 only |
Bbr2 of Schizophyllum commune | R2: TGTGCTTTTCGCTCTTAGCA | |||||
Contig660 | 4 | Rcb2 of C. cinerea | F: ACGATTCCAGTAGGCGTGAA | 551 | 800 | A1 only |
B alpha 8 of S. commune | R: CTGCGTCACGATACCTTTCTT | |||||
Contig2096 | 3 | Bbr2 of S. commune | F: TCCTTTGTCACGACAAGCAC | 213 | 220 | A1 only |
Rcb3 of C. cinerea | R: CCAATTTTCACGCCTACTGG | |||||
Singlet pr0aaa87yh06 | 1 | Rcb1 of C. cinerea | F: ATCAGAATATGACGGCAGCA | 383 | 600 | A2 only |
Bbr2 of S. commune | R: AAGAAAGGGAACTCCAAATGC |