Skip to main content

Table 2 Unisequences of Microbotryum violaceum blasting against pheromone receptors. For each of the four unisequences significantly blasting against pheromone receptors: best hits, primer designed for PCR amplification, expected size from the EST sequence, rough amplification size obtained, and mating type of the sporidia that gave amplification products.

From: Expressed sequences tags of the anther smut fungus, Microbotryum violaceum, identify mating and pathogenicity genes

  Number of ESTs Best hits Primers Contig size obtained from ESTs Rough amplification size Amplification in sporidia of mating type
Contig588 3 Rcb1 of Coprinopsis cinerea F1: GGAAGGCCATTACAAGAAAGG 350 500 A2 only
   Bbr2 of Schizophyllum commune R2: TGTGCTTTTCGCTCTTAGCA    
Contig660 4 Rcb2 of C. cinerea F: ACGATTCCAGTAGGCGTGAA 551 800 A1 only
   B alpha 8 of S. commune R: CTGCGTCACGATACCTTTCTT    
Contig2096 3 Bbr2 of S. commune F: TCCTTTGTCACGACAAGCAC 213 220 A1 only
   Rcb3 of C. cinerea R: CCAATTTTCACGCCTACTGG    
Singlet pr0aaa87yh06 1 Rcb1 of C. cinerea F: ATCAGAATATGACGGCAGCA 383 600 A2 only
   Bbr2 of S. commune R: AAGAAAGGGAACTCCAAATGC    
  1. 1 F: Forward primer
  2. 2 R: Reverse primer