Skip to main content

Table 6 Primers for RT-PCR

From: Mapping of oxidative stress responses of human tumor cells following photodynamic therapy using hexaminolevulinate

Gene Symbol Primer  
HIST1H2AM Forward primer: 5' TAGGCCACAGGTCGTTTTACCA
  Reverse primer: 5' GGAAATTGGAGCCCAGCTCTAG
HIST1H3C Forward primer: 5' AAGTCCACCGAGCTGCTGAT
  Reverse primer: 5' AACGCAGGTCGGTTTTGAAG
HIST2H2AB Forward primer: 5' CATCATCCCTCGCCATCTG
  Reverse primer: 5' AATGGTGACACCCCCGAGTA
MT1B Forward primer: 5' GCAAGAAGTGCTGCTGCTCTT
  Reverse primer: 5' TGATGAGCCTTTGCAGACACA
MT1G Forward primer: 5' CCTGTGCCGCTGGTGTCT
  Reverse primer: 5' TGCAGCCTTGGGCACACT
HIST1H1C Forward primer: 5' GCGGCCACTGTAACCAAGA
  Reverse primer: 5' AGCAGCACTTTTGGCAGCTT
MT-ND5 Forward primer: 5' GATGATACGCCCGAGCAGAT
  Reverse primer: 5' AGGCGAGGATGAAACCGATAT
MT-ND2 Forward primer: 5' TCCAGCACCACGACCCTACT
  Reverse primer: 5' TTCGATAATGGCCCATTTGG
MT-CYB Forward primer: 5' CCCTAGCCAACCCCTTAAACA
  Reverse primer: 5' GGACGGATCGGAGAATTGTG